'aligned trnL intron sequences for Gentianaceae and outgroups, 30 October 1998, see Struwe et al., Harvard Papers in Botany, vol. 3, note that Genbank numbers follow taxon names'

750 151 

Alstonia_boonei_AF102374                AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTGTTTT----------------CCACAA-------AC----------------AAAGGTTCAG---------AAAACGAAAA-A---------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTTAC-------AAATGGA--------GTTGGCCG-C-------GTTGGTAGA-GAAA-------TCTTTCCATCGAAAATTCAG-----------------------------------------AA--GATAAACG------TATA-------TACAT-ACG---------TATTGAATACTATAT-----------------CAAAT-----GATTAATGC-C----GACCCGAATGAAT----CTGTATTT-TTTCTATGA----AAAATGGAGGAATT------GGTGTGAT-----TCGATTCCACATTGAAGAAAGAA-----TCGAATATTCATTGATCAAATGATTCACTCCATAGTCTG-AAGA---TCTTT--TGAAGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------TAGAGTCCCGTTCTACA-TGTCAATGCCGGCAACAATG-----------------AAATTTATAGT-AAGAGG   
Anthocleista_amplexicaulis_AF102375     AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-CAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------CTTTTTCCAAAAACAAAAAGCAAAAAG----------AAAGGCTCAG---------AAAGAAAAAAAAAA-------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAAA-GAAA-------CCTTTGCATCAAAAATTCCG-----------------AAAGTAT----------------AAAG-AAAAAAGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCACAGCCTG-TAGA---TCTTT--TCACGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-AAGAGG   
Anthocleista_scandens_AF102376          AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-CAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------CTTTTTCCAAAAA------GCAAAAAG----------AAAGGCTCAG---------AAAGAAAAAAAAA--------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAAA-GAAA-------CCTTTGCATCAAAAATTACG-----------------AAAGTAT----------------AAAG-AAAAAAGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAA-CCACAGCCTG-TAGA---TCTTT--TCACGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-AAGAGG   
Anthocleista_vogelii_AF102377           AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-CAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------CTTTTTCCAAAAA------GCAAAAAG----------GAAAG?TCAG---------AAAGRAAAAAAAA--------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAAA-GAAA-------CCTTTGCATCAAAAATTCCG-----------------AAAGTAT----------------AAAG-AAAAAAGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCACAGCCTG-TAGA---TCTTT--TCACGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-AAGAGG   
Antirhea_acutata_AF102378               -ATTGGATTGAGCCTTGGTATGGAAACCCACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCCGTTTT----------------CCGAAA-------CC----------------AAAGGTTCAG---------AAAGTGAAAAAA---------AGGATAGGTGCAGAGACTCAACGGAAGTT-GTTCTAAC-------AAATGGA--------GTTGGCTG-C-------GTTAGTAGA-GAAA-------TCTTTCCATCGAAAATTCAA-----------------AAAGAAT-----------GAAGTGAAG-GATAAACG------TATA-------TACAT-ACG---------TATTGAATACTATAT-----------------CAAAT-----GATTAATGA-C----GACCCAACTGAAT----CTGTATTTTTATATACGG---AAAAACGGAAGAATT------GGTGTGAA-----TAGATTCCACATTGAAGAAAGAA-----TCGAATATTCATTGATCAAATGATTCACTCCATAGTCTGATAGA---TCTTT--TCAAGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------TAGAGTCCCGTTCTACA-TGTCAATGCCGGCAACAATG-----------------AAATTTATAGT-AAGAGG   
Antonia_ovata_AF102379                  ----------------GGTATGGAAACCTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATTCTGAGCCAAATCCCGTTTT----------------CCGAAA-------AC----------------AAAGGTTCAG---------AAAGCGAAGAA----------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGGCTG-C-------GTTGGTAGA-GAAA-------TCTTTCCATCGAAAATTCAG-----------------AAAGCAT----------------GAAG-GATAAACG------TATA-------TACAT-ACG---------TAGTGAATACTAGAT------------------------------TAATGA-T----AACCAGAATGAAT----CTGTATTT-TTTATATGAG--AAAAATAGAAGAATT------GGTGTGAA-----TCGTTTCCACATTGAAGAAAGAA-----TCGAATATTCATTGATCAAATGATTCACTCCACAGTCT-ATAGA---TTTTT--TCAAGAAATG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------TAGAGTCCCGTTCTACA-TGTCAATGCCGGCAACAATG-----------------AAATTTATAGT-AAGAGG   
Apocynum_cannabinum_AF102380            AATTGGATTGAGCCTTGGTAAGGAAACCTACTAAGTGATGACTTTCAAATTCAGAGAAACCCCGGAATTAAC---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTT----------------CCACAA-------AC----------------AAAGGTTCCG---------AAAACGAAAACA---------AGGATAGGTGCAGAGACTCGACGGAAGCT-ATTCTAAC-------AAATGGA--------GTTGGACG-C-------GTTGGTAGA-GAAA-------TCTTTCCATCGAAAATTCAG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AATTGATCAAACGATTCACTCCATAGTCTG-TTGATCCTCTTT--TCAAGAACGG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------TAGAGTCCCGGTCTACA-TGTCAATGCTGGCAACAATG-----------------AAATTTATAGT-AAGAGG   
Asclepias_curassavica_AF102381          AATTGGATTG-GCCTTGGTAGGGAA-CCTATTAAGTGATGACTTTCAAATTCAGAGAAACCCCGGAATTAAG---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTT----------------CCACAA-------AC----------------AAAGGTTCAG---------AAAACGAAAACA---------AGGATAGGTGCAGAGACTCGACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGGGCG-CGTTGGTAGTTGGTAGA-GAAC-------TCTTTCCATCGAAAATTCAG-----------------AAAGGAG----------------GAAA-G--------------ATA-------TACAT-ACG---------TATTGACTACTATATCAAA-T-------ATATCAAAT-----GATTAATGC-C----GACCCCAATGAGT----CTATATTT-TTTCTATAAAAAAAAAACGGAAGAATT------GATGTGAT-----TCGATTCTTTCTTCAATGTGGAA-----TCGAATATTCATTGAT---------CACTCCATAGTCTG-TAGATCCTCTTT--TCAAGAACCGG--ATTAAT-------C-GGACGA-GAA-TAAAGA-------TAGAGTCCCGTTCTACA-TGTCAATGGTGGCAACAATG-----------------AAATTTTTAGT-AAGAGG   
Aspidosperma_megalocarpon_AF102382      AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAA-----------------A-AAA-GGGCAATCCTGAGCCAAATCCTGTTTT----------------CCACAA-------AC----------------AAGGGTTCAG---------AAAACGAAAA-A---------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGGCCG-C-------GTTGGTAAA-GAAA-------TCTTTCCATCAAAAATTCAG-----------------AAAGGAT----------------GAAG-GATAAACG------TATA-------TACAT-ACG---------TATTGAATACTATAT-----------------CAAAT-----GATTAATGA-C----GACCCGAATGAAT----CTGTATTT-TTTCTATGA----AAAATGGAAGAATT------GGCGGGAA-----TCGATTCCACATTGAAGAAAGAA-----TCGAATATTCATTGATCAAACGATTCACTCCATAGTCTG-TAGA---TCTTT--TCAAGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------TAGAGTCCCGTTCTACA-TGTCAATGCCGGCAACAATG-----------------AAATTTATAGT-AAGAGG   
Bartonia_virginica_AF102383             AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGTTAATTTTCAAATTCAGAGAAAGCCTGGAATTAAT---------------AA-AAA-GGTCAATCCTGAGCCAAATCCTATT-------------------AAAA--------GGAAAAAG----------AAAGACTTAA---------ACAGAAAAA------------GGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAACATCTAACAAATAGA--------GTTAATTG-C-------GTTGGTAAC-GAAA-------CTTTTTCACAACAAATTATA-----------------AAAGGAT----------------GAAA-AAGAAAAG------TATA-------TCCC---------------------AACTATAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAT-CCACAGACTG-TAGA---TCTTT--TCAAGAAATG---ATTAAT-------T-GGACGA-GGA-TAAAGA-------GAGAGTCCCATTCTGCA-TGTCAATGCCGACAACAATG-----------------CAATTTATAGC-GAGAGG   
Blackstonia_imperfoliata_AF102384       AATTGGATTGAGCCTTGGTATGGAAACCTACTGAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AATAAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------------CCAAAA-------AG-AAAAG----------AGAGGCTCAG---------AAAGCAAAAAAA---------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAGA-GAAA-------TAGTTCCATCAAAAATTCCG-----------------AAAAGAT----------------GAAG-AAGAAAGG------TATA-------TACAT-ACG---------GATGGAAGACTCTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAAAGATTCAC-CCAGAGCCTG-TAGA---TCTTT--TCAAGATCTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAAGAATG-----------------AAATTTATAGT-AAGAGG   
Bonyunia_minor_AF102385                 ??????ATTGAGCCTTGGTATGGATACCTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATTCTGAGCCAAATCCCGTTTT----------------CCGAAA-------AC----------------AAAGGTTCAG---------AAAGCGAAGAA----------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGGCTG-C-------GTTGGTAGA-GAAA-------TCTTTCCATCGAAAATTCAG-----------------AAAGCAT----------------GAAG-GATAAACG------TATA-------TACAT-ACG---------TAGTGAATACTAGAT------------------------------TAATGA-T----AACCAGAATGAAT----CTGTATTT-TTTATATGAG--AAAAATGGAAGAATT------GGTGTGAA-----TCCTTTCCACATTGAAGAAAGAA-----TCGAATATTCATTGATCAAATGATTCACTCCACAGTCT-ATAGA---TTTTT--TCAAGAAATG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------TAGAGTCCTGTTCTACA-TGTCAATGCCGGCAACAATG-----------------A-----------------   
Bonyunia_superba_AF102386               -ATTAGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATTCTGAGCCAAATCCCGTTTT----------------CCGAAA-------AC----------------AAAGGTTCAG---------AAAGCGAAGAA----------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGGCTG-C-------GTTGGTAGA-GAAA-------TCTTTCCATCGAAAATTCAG-----------------AAAGCAT----------------GAAG-GATAAACG------TATA-------TACAT-ACG---------TAGTGAATACTAGAT------------------------------TAATGA-T----AACCAGAATGAAT----CTGTATTT-TTTATATGAG--AAAAATGGAAGAATT------GGTGTGAA-----TCCTTTCCACATTGAAGAAAGAA-----TCGAATATTCATTGATCAAATGATTCACTCCACAGTCT-ATAGA---TTTTT--TCAAGAAATG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------TAGAGTCCCGTTCTACA-TGTCAATGCCGGCAACAATG-----------------AAATTTATAGT-AAGAGG   
Calolisyanthus_pendulus_AF102387        AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------AATAATAA-AAA-GGGCAATTCTGAGCCAAATCCTATTTTTT--------CTTTTTCAAAAA-------GCAAAAAG----------AAAGGCTCAG---------AAAGCAAAAAAAA--------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAAA-GAAA-------CCTTTCCATCCAAAATTCCG-----------------AAAGGAT----------------GAAG-AAGAAAGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCCCAGCCTG-TAGA---TCTTT--TCACGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-AAGAGG   
Calolisyanthus_pulcherrimus_AF02388     AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------AATAAAAA-AAA-GGGCAATTCTGAGCCAAATCCTATTTTTT--------CTTTTTCAAAAA-------GCAAAAAG----------AAAGGCTCAG---------AAAGCAAAAAAAAA-------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAAA-GAAA-------CCTTTCCATCCAAAATTCCG-----------------AAAGGAT----------------GAAG-AAGAAAGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCCCAGC?TG-TAGA---TCTTT--TCACGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-AAGAGG   
Canscora_diffusa_AF102389               AATTGGATTGAGCCTTGGTATGGAAACCTACTGAGTGATAATTTTCAAATTCAGCGAAACTCTGGAATTAAT---------AATAAAAA-AAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------------CAAAAA-------ACAAAAAG----------AAAGGCCCAG---------AAAG-AAAAA-----------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------CAATGGA--------GTTGATTG-CGTTGGT-GTTGGTCGA-GAAA-------TATTTCCATCGAAAATTCCG-----------------AAAGGAT----------------CAAT-AAGAAAGG------TATA-------TACAT-ACG---------TATGGAAAACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAGTGATTCAC-CCATATCTTG-TATA---TCTTT--TCAAGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTACA-TGTCAATGCCGACAAGAATG-----------------AAATTTATAGT-AAGAGG   
Canscora_pentanthera_AF102390           AATTGGATTGAGCCTTGGTATGGAAACCTACTGAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------------CAAAAA-------ACAAAAAG--AAAAG---AAAGGCCCAG---------AAATAAAAAA-----------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAGA-GAAA-------TATTTCCATCGAAAATTCCG-----------------AAAGGAT----------------GAAT-ACGAAAGG------TATA-------TACAT-ACG---------TATGGAAGACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAGCGATTCAC-CCATACCTTG-TAGA---TCTTTA-TCAAGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTACA-TGTCAATGCCGACAAGAATG-----------------AAATTTATAGT-AAGAGG   
Carissa_bispinosa_AF102391              AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATGACTTTCAAATTCAGAGAAACCCCGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCAGTTTT----------------CCACAA-------AC----------------AAAGATTCAG---------AAAACGAAAACA---------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGGCCG-C-------GTTGGTAGA-GAAA-------TCTTTCCATCGAAAATTCAG-----------------AAAGGAT----------------GAAG-GATAAACG------TATA-------TACAT-ACG---------TATTGAATACTATAT-----------------CAAAT-----GATTAATGC-C----GACCCGAATGAAT----CTGTATTT-TTTCTATAA----AAAATGGAAGAATT------GGTGTGAT-----TCGATTCTTTCTTCAATGTGGAA-----TCGAATATTCATTGATCAAATGATTCACTCCATAGTCTG-TAGA---TCTTT--TCAAGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------TAGAGTCCCGTTCTACA-TGTCAATGCTGACAACAATT-----------------AAATTTATAGT-AAGAGG   
Catharanthus_roseus_AF102392            AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAACTTTCAAATTCAGAGAAACCCCGGAATTAAT---------------AA-AAG-GGGCAATCCTGAGCCAAATCCAGTTTT----------------CCACAA-------ACACAAAC----------AAAGGTTCAG---------AAAACGAAAA-A---------GGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGACAAATGGAGTTGGCCG-C-------GTTGGTAGA-GAAA---CAAACCTTTCCATCCAAAATTCAG-----------------AAAGGAT----------------GAAG-GATAAACG------TATA-------TACAT-ACG---------TATTGAATACTATAT-----------------CAAAT-----GATTAATGC-C----GACCCGAATGAAT----CCGTATTT-TGTCTATAA-----AAATGTAAGA--------------GAT-----TCGATTCCACATTGAAGAAAGAA-----TCGAATATTCATTGATCAAATGATTCACTCCATAGTCTG-TAGA---TCTTT--TCAAGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------TAGAGTCCCGTTCTACA-TGTCAATGCTGGCAACAATG-----------------AAATTTATAGT-AAGAGG   
Centaurium_cf_barrelieri_AF102393       AATTGGATTGAGCCTTGGTATGGAAACCTACTGAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AATAAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------------CCAAAA-------ACAAAAAG--AAAAG---AAAGGCTCAG---------AAAGCAAAAAAAAAAAAAAAAAGGATAGGTGCAGAGACTCAAAGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAGA-GAAA-------TATTTCCATCGAAAATTCCG-----------------AAAGGAT----------------GAAG-AAGAAAGG------TATA-------TACAT-ACG---------GATGGAAGACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCATAGCCTG-TAGA---TCTTT--TCAAGATCTG---ATTAAT-------C-AGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAAGAATG-----------------AAATTTATAGT-AAGAGG   
Centaurium_maritimum_AF102394           AATTGGATTGAGCCTTGGTATGGAAACCTACTGAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AATAAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------------CCAAAA-------ACAAAAAG--AAAAG---AAAGGCTCAG---------AAAGCAAAAAAAAA-------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAGA-GAAA-------TATTTCCATCGAAAATTCCG-----------------AAAGGAT----------------GAAG-AAGAAAGG------TATA-------TACAT-ACG---------GATGGAAGACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCATAGCCTG-TAGA---TCTTT--TCAAGATCTG---ATTAAT-------C-AGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATACCGACAAGAATG-----------------AAATTTATAGT-AAGAGG   
Cerberiopsis_candelabra_AF102395        AATTGGATTGACCCTTGGTATGGAAACCTACTAAGTGATAACTTTCAAACTCAGAGAAACCCCGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTGTTTT----------------CCACAA-------AC----------------AAAGGTTCAG---------AAAACGAAAACA---------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGGCCG-C-------GTTGGTAGA-GAAA-------TCTTTCCATCGAAAATTCAG-----------------AAAGGAT----------------GAAG-GATAAACG------TATA-------TACAT-ACG---------TATTGAATACTATAT-----------------CAAAT-----GATTAATGC-C----GACCCGAATGAAT----CCGTATTT-TTTCTATAA-----AAATGGAAGAATT------GGTGTAAT-----TCGATTCTTTCTTCAATGTGGAA-----TCGAATATTCATTGATCAGATGATTCACTCCATAGTCTG-TAGA---TCTTT--TCAAGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------TAGAGTCCCGTTCTACA-TGTCAATGCTGGCAACAATG-----------------AAATTTATAGT-AAGAGG   
Chelonanthus_alatus_AF102396            AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------AATAATAA-AAA-GGGCAATTCTGAGCCAAATCCTATTTTTG--------CTTTTTGAAAAA-------GCAAAAAG----------AAAGGCTCAG---------AAAGCAAAAAAAA--------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGGAAA-GAAA-------CCTTTCCATCAAAAATTCCG-----------------AAAGGAT----------------GAAG-AAGAAAGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-TCCCAGCCTG-TAGA---TCTTT--TCACGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-AAGAGG   
Chelonanthus_albus_AF102397             AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------AATAATAA-AAA-GGGCAATTCTGAGCCAAATCCTATTTTTG--------CTTTTTCAAAAA-------GCAAAAAG----------AAAGGCTCAG---------AAAGCAAAAAAAAA-------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGGAAA-GAAA-------CCTTTCCATCAAAAATTCCG-----------------AAAGGAT----------------GAAG-AAGAAAGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCCCAGCCTG-TAGA---TCTTT--TCACGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTT?TGCA-TGTCAATGCCG?CA??AATG-----------------AAATTTATA??-ATGAGG   
Chelonanthus_purpurascens_AF102398      AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------AATAAAAA-AAA-GGGCAATTCTGAGCCAAATCCTATTTTTT--------CTTTTTCAAAAA-------GCAAAAAG----------AAAGGCTCAG---------AAAGCAAAACAAAAAAAAA--AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGGAAA-GAAA-------CCTTTCCATCAAAAATTCCG-----------------AAAGGAT----------------GAAG-AAGAAAGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCCCAGCCTG-TAGA---TCTTT--TCACGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-AAGAGG   
Chelonanthus_viridiflorus_AF102399      AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAATAAT---AATAA-AATAA-AAA-GGGCAATTCTGAGCCAAATCCTATTTTTG--------CTTTTTCAAAAA-------GCAAAAAG----------AAAGGCTCAG---------AAAGCAAAAAAAA--------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGGAAA-GAAA-------CCTTTCCATCAAAAATTCCG-----------------AAAGGAT----------------GAAG-AAGAAAGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCCCAGCCTG-TAGA---TCTTT--TCACGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-AAGAGG   
Chiococca_alba_AF102400                 --TTGGATT-GACCTTGGTATGGAAACCCACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAAGGGGCAATCCTGAGCCAAATCCTGTTTT----------------TCGAAA-------CC----------------AAAGGTTCAG---------AAAGTGAAAAAA---------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GCTGGCTG-C-------GTTAGTAGA-GAAA-------TCTTTCCATCCAAAATTCAG-----------------AAAGAAT-----------GAGGTGAAG-GAGAAACG------TATA-------TACAT-ACG---------TATTGAATACTATATCAAAAT-----------CAAAT-----GATTAATGA-C----GACTCGACAGAAT----CTGTATTTATATATATAA----AAAACGGAAGAATT------AATGTGAA-----TAGATTCCACATTGAAGAAAGAA-----TCGAATATTCATTGATCAAATGATTCACTCCATAGTCTGATAGT---TCTTT--TCAAGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------TAGAGTCCTGTTCTACA-TGTCAATGCCGGCAACAATG-----------------AAATTTATAGT-AAGAGG   
Chionogentias_bellidifolia_AF102401     ATTAGGATTGAGCCTTGGTATGGAAACCTGCTAAGTGCTAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAG-GGGCAATCCTGAGCCAAATCCTATTAAATAT------TAAAAT-AAAAAAA-----GCAAAAAG----------AAAGGCTCAG---------AAAGAAAAAAA----------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAAA-GAAA-------CCTTTTCACCAAAAATTCCG-----------------AAAGGAT----------------GAAA-AAGAAAGG------TATA-------TACA---------------------AACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCACAGCCTG-TGGA---TCTTT--TCACGAAATG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-GAGAGG   
Chironia_baccifera_AF102402             AATTGGATTGAGCCTTGGTATGGAAACCTACTGAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AAAAAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------------CCAAAA-------ACAAAAAG--AAAAG---AAAGGCTCAG---------AAAGCAAAAAAAAAAA-----AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAGA-GAAA-------TATTTCCATCGAAAATTCCG-----------------AAAGGAT----------------GAAG-AAGAAAGG------TATA-------TACAT-ACG---------GATGGAAGACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCATAGCCTG-TAGA---TCTTT--TCAAGATCTG---ATTAAT-------C-AGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAAGAATG-----------------AAATTTATAGT-AAGAGG   
Cicendia_filiformis_AF102403            AATTGGATTGAGCCTTGGTATGGAAACCTACTGAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AATAAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------------CCAAAA-------ACAAAAAG----------AAAGGCTTAG---------AAAA-AAAA------------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTA-C-------GTTGGTAGA-GAAA-------TATTTCCATCACAAATTCCG-----------------AAAGGAT----------------GAAG-AAGAAAGG--TATATATA-------TACAT-ACG---------GATGGACGACTATAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGA-------CATAGCCTG-TAGA---TCTTT--TCAAGATCTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAAGAATG-----------------AAATTTATAGT-AAGAGG   
Cicendia_quadrangularis_AF102404        AATTGGATTGAGCCTTGGTATGGAAACCTACTGAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AATAAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------------ACAAAA-------ACAAAAAG----------AAAGGCTTAG---------AAAACAAAAAAAAAA------AGGATAGGTGCAGAGACTCAACGGAAGCT-ATTCTAAC-------AAATGGG--------GTTGATTA-C-------GTTGGTATA-GAAA-------TATTTCCATCAAAAATTCCG-----------------AAAGGAT----------------GAAG-AAGAAAGG--TATATATA-------TACAT-ACG---------GATGGACGACTATAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGA-------CATAGCCTG-TAGA---TCTTT--TCAAGATCTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAAGAATG-----------------AAATTTATAGT-AAGAGG   
Coffea_arabica_AF102405                 --------------TTGGTATGGAAACCCACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAAGGGGCAATCCTGAGCCAAATCCCGTTTT----------------CCGAAA-------CCAAAGG-----------AAAGGTTCAG---------AAAGTGAAAAA----------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGGCTG-C-------GTTAGTAGA-GAAA-------TCTTTCCATCTAAAATTCCG-----------------AAAGGAT-----------AAAGTGAAG-GATAAACG------TATA-----------T-ACG---------TATTGAATACTATAT-----------------TAAAT-----GATTAATGA-C----GACTCAACTGAAT----CTGTATTTTT-TATAT-A----AAAATGGAAGAATT------GGTGTGAA-----TAGATTCCACATTGAAGAAAGAA-----TCGAATATTCATTGATCAAATGATTCACTCCATAGTCTGATAGA---TCTTT--TCAAGAATTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------TAGAGTCCCGTTCTACA-TGTCAATGTCGGCAACAATG-----------------AAATTTATAGT-AAGAGG   
Comastoma_nana_X77890                   AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGCTAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAG-GGGCAATCCTGAGCCAAATCCTAG--------------------AAAAAAA-----GCAAAAAG--AAA-----G???GCTCAG---------AAAGAAAAAA-----------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAAA-GAAA-------CCTTTTCACCAAAAATTCCG-----------------AAAGGAT--GAAAAA--------GA---AAG???G-------TATA-------TACA---------------------AACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCACAGCCTG-TGGA---TCTTT--TCACGAACTT---ATAAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATACCGACAACAATG-----------------AAATTTATAGT-GAGAGG   
Comastoma_tenella_X77892                AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGCTAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAG-GGGCAATCCTGAGCCAAATCCTAG--------------------AAAAAA------GCAAAAAG----------AAAGGCTCAG---------AAAGAAAAAA-----------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAAA-GAAA-------CCTTTTCACCAAAAATTCC------------------AAAG-AT----------------GAAA-AAGAAAG-------TATA-------TACA---------------------AACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------GAAATGATTCAC-CCACAGCCTG-TGGA---TCTTT--TCACGAACTT---ATTAAT-------C-G-ACGA-GAA-TAAAGA-------GAGAGTCCCGTTATGCA-TGTCAATACCGACAACAATG-----------------AAATTTATAGT-GAGAGG   
Condaminea_corymbosa_AF02406            -ATTGGATTGAGCCTTGGTATGGAAACCCACTAAGTGATAACTTTCAAATTCAGAGAAACCCCGGAATTAAT---------------AA-AAAGGGGCAATCCTGAGCCAAATCCTGTTTT----------------CCGAAA-------CC----------------AAAGGTTCAG---------AAAGTGAAAAA----------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGGCTG-C-------GTTAGTAGA-GAAA-------TCTTTCCATCGAAAATTCAG-----------------AAAGGAT-----------AAAGTGAAG-GATAAACG------TATA-------TACAT-ACG---------TATTGAATACTATAT-----------------CAAAT-----GATTAATGA-C----AACCCGACTGAAT----CTGTATTTTTTTATATGA----AAAACGGAAGAATT------GGTGTGAA-----TAGATTCCACATTGAAGAAAGAA-----TCATATATTCATTGATCAAATGATTAACTCCATAGTCTGATAGA---TCTTT--TCAAGAAATG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------TAGAGTCCCGTTCTACA-TGTCAATGTCGGCAACAATG-----------------AAATTTATAGT-AAGAGG   
Coutoubea_minor_AF102407                AATTGGATTGAGCCTTGGTATGGAAACCTGCTGAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT-------AAATTAATAA-AAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------------CCAAAA-------ACAAAAAT--AAAAG---AAAGGTTCAG---------AAAGCAAAAAA----------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTAATTA-C-------GTTGGTAGA-GAAA-------TCGTTCCATCGAAAACTCCG-----------------AAAGGAT-----------GAA--GAATAAAG-GACG------TATA-------TA----------------------AGACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCATAGCCTG-TCGT---TCTTT--TCACGAACTA---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCAACAAGAATGCATTGCCGACAAGAATTAAATTTCTAGT-AAGAGG   
Coutoubea_ramosa_AF102408               AATTGGATTGAGCCTTGGTATGGAAACCTACTGAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------------CAAAAA-------ACAAAAAT--AAAAG---AAAGGTTCAG---------AAAGCAAAAAAAAA-------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTAATTG-C-------GTTGGTAGA-GAAA-------TAGTTCCATCGAAAATTCCG-----------------AAAGGAT----------------GAAG-AAGAAAGG------TATA-------TACAT-ACG---------TATGGAAGACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCATAGCCTG-TAGT---TCTTT--TCACGAACTA---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCAACAAGAATGCATTGCCGACAAGAATGAAATTTATAGT-AATAGG   
Coutoubea_spicata_AF102409              AATTGGATTGAGCCTTGGTATGGATACCTACTGAGTGATAATTT-CAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------------CAAAAA-------ACAAAAAT--AAAAG---AAAGGTTCAG---------AAAGCAAAAAAAAA-------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTAATTG-C-------GTTGGTAGA-GAAA-------TAGTTCCATCGAAAATTCCG-----------------AAAGGAT----------------GAAG-AAGAAAGG------TATA-------TACAT-ACG---------TATGGAAGACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCATAGCCTG-TAGT---TCTTT--TCACGAACTA---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCAACAAGAATGCATTGCCGACAAGAATGAAATTTATAGT-AATAGG   
Deianira_pallescens_AF102410            AATTGGATTGAGCCTTGGTATGGAAACCTACTGAGTGATAATTTTCAAATTCAGAGAACCCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------ATTTTTCCAAAA-------ACAAAAAG--AAAAG---AAAGGTTCAG---------AAAGCAAAAAAA---------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAGA-GAAA-------TAGTTCCATCGAAAATTCCG-----------------AAAGGAT----------------GACG-AAGAAAGG------TATA-------TACAT-ACG---------TATGGAAGACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCATAGCCTG-TAGA---TCTTT--TCAAGAACTA---ATTAAT-------C-AGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCAACAAGAATGCATTGCCGACAAGAATGAAATTTATAGT-AAGAGG   
Dioicodendron_dioicum_AF102411          -ATTGGATTGAGCCTTGGTATGGAAACCCACTAAGTGATAACTTTCAAATTCAGAGAAACCCCGGAATTAAT---------------AA-AAAGGGGCAATCCTGAGCCAAATCCTGTTTT----------------CCGAAA-------CC----------------AAAGGTTCAG---------AAAGTGAAAAA----------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGGCTG-C-------GTTAGTAGA-GAAA-------TCTTTCCATCGAAAATTCAG-----------------AAAGGAT-----------AAAGTGAAG-GATAAACG------TATA-------TACAT-ACG---------TATTGAATACTATAT-----------------CAAAT-----GATTAATGA-C----AACCCGACTGAAT----CTGTATTTTTTTATATGA----AAAACGGAAGAATT------GGTGTGAA-----TAGATTTCACATTGAAGAAAGAA-----TCATATATTCATTGATCAAATGATTAACTCCATAGTCTGATAGA---TCTTT--TCAAGAACTG---ATTAAT-------C-AGACGA-GAA-TAAAGA-------TAGAGTCCCGTTCTACA-TGTCAATGTCGGCAACAATG-----------------AAATTTATAGT-AAGAGG   
Ditassa_sp_AF102412                     AATTGGATTGAGCCTTGGTAAGGAAACCTACTAAGTGATGACTTTCAAATTCAGAGAAACCCCGGAATTAAG---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTT-------------------------------------------------CGGTTCAG---------AAAATGAAAACA---------AGGATAGGTGCAGAGACTCGACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGGCCG-C-------GTTGGTAGA-GAAA-------TCTTTCCATCGAAAATTCAG-----------------AAAGGAT----------------GAAA-G--------------ATA-------TACAT-ACG---------TATTGAATACTATAT-----------------GAAAT-----GATTAATGC-G----GACCCAAATGAGT----CTATATTT-TTTCTATAA----AAAACGTAAGAATT------GGTGTGAT-----TCGATTCTTTCTTCAATGTGGAA-----TCGAATATTCATTGATCAAAAGATTCACTCCATAGTCTG-TAGATCCTCTTT--TCAAGAACCGG--ATTAAT-------C-GGACGA-GAA-TAAAGA-------TAGAGTCCCGTTGTACA-TGTCAATGCTGGCAACAATG-----------------AAATTTTTAGT-AAGAGG   
Djaloniella_ypsilostyla_AF102413        AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCACATTCAGAGAAACCCTGGAATTAAG---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTTT-----------TTTTCAAAAA--------CAAAAAG----------AAAGTCTCAG---------AAAGAAAAAAAA---------AGGATAGGTGCAGAGACTCAACGGAAGTT-GTTCTAAC-------AAATGGA--------GGTGATTA-C-------GTTGGTAAA-GAAA-------CCTTTGCATCAAAAATTTTG-----------------AAAGGATAAAAAAGGAT------AAAG-AAGAAAGG------TATA-------TACA---------------------AACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAT-CCACAGCCTG-TCGA---CCTTT--TCACGAACTG---ATTAAT-------C-GTACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGTCGACAACAATG-----------------AAATTTAGAGT-AAGAGG   
Echium_vulgare_L33362                   --------TGAGCCTTGGTATGGAAACCTACTAAGTGACAACTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA?GGGCAATCCTGAGCCAAATCCGGTTTT----------------CCGAAA-------ACAAAC------------AAAAGTTGAA---------AAAG-AAAAA-----------AGGATAGGTGCAGAGACTCAATGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGACTG-C-------TTTGGTCGA-CGAA-------TCTTTC--TC------------------------AT-AAAGTGT----------------GAAA-G-------------TATA-------TACAT-TTG---------TATTGAATACTTTAT-----------------CAAATGAAATGATTAATGA-C-----TCCCAAAA---------TATATTTTTTTTT?AAA---AAAAAAAGAAGAGTT------GGTGTTAA-----TCAATTCCACATAGAAGAAAGAAAAGAGTCGAGTATTCATTGATCAAATTATTCACTCCATAGTCCGATAGA---TCTTT--TGAAGAATTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------TAGAGTCCCGTTCTACA-TGTCAATACCGGCAACAATG-----------------AAATTTTTAGT-AATAGG   
Enicostema_verticillatum_AF102414       AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTTT-------------TTCAAAAA-------GCAAAAAG-ACAAAG---AAAGGCTCAG---------AAAGAAAAAA-----------AGGATAGGTGCAGAGACTCAACGGAAGTT-GTTCTAAC-------AAATGGA--------GTTGATTA-C-------GTTGGTAAA-CAAA-------CCTTTGCATCCAAAATTTCG-----------------AAAGGATAAAAAAGGAT------AAAG-AAGAAAGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCACAGCCTG-TAGA---TCTTT--TCACGAACCG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-AAGAGG   
Eustoma_exaltatum_AF102415              AATTGGATTGAGCCTTGGTATGGATACCTACTGAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AATAAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------------CCAAAA-------ACAAAAAG----------AAAGGCTCAG---------AAAGCAAAAAAAAAAAAAAA-AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAGA-GAAA-------TATTTCCATCGAAAATTCCG-----------------AAAGGAT----------------GAAG-AAGAAAGG------TATA-------TACAT-ACG---------GATGGAAGACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCATAGCCTG-TAGA---TCTTT--TCAAGATCTG---ATTAAT-------C-AGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAAGAATG-----------------AAATTTATAGT-AAGAGG   
Eustoma_grandiflorum_AF102416           -??TGGATTGAGCCTTGGTATGGATACCTACTGAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AATAAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------------CCAAAA-------ACAAAAAG----------AAAGGCTCAG---------AAAGCAAAAAAAAAAAAAA--AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAGA-GAAA-------TATTTCCATCGAAAATTCCG-----------------AAAGGAT----------------GAAG-AAGAAAGG------TATA-------TACAT-ACG---------GATGGAAGACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCATAGCCTG-TAGA---TCTTT--TCAAGATCTG---ATTAAT-------C-AGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAAGAATG-----------------AAATTTATAGT-AAGAGG   
Exacum_affine_AF102417                  AATTGGATTGAGCCTTGGTATGGATACCTACTAAGTGATAACTTTCCAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTT------------TTTTACGAAA-------AG----------------AACGTGTCAG---------AAAGCAAAAA-----------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAGA-TAAA-------TCTTTCCTTC-AAAATTCCG-----------------AAAGGCT----------------GAAG-AAGAAAGG------TATA-------TACAT-ACG---------TATGGAATATTGTAT-----------------CAAAT-----GATTAATGA-T----GACCCGAATAAAT----CTGTATTTTT-TCTATGA----AAAATGTAAGAATT------GGTGTGAA-----GCGATTCCACATTCAAGAAAAAA-----TCGAATATTCGTTGATCAAATGATTCACTCCATAGTCTG-TAGG---TCTTT--TTAAGAACT----ATTAAT-------T-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATAACGACAACAATG-----------------CAATTTATAGT-ACGAGG   
Exacum_tetragonum_AF102418              AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAACTTTCCAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTT------------TTTTCCGAAA-------AG----------------AACGGGTCAG---------AAAGCAAAAA-----------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTGGATTG-C-------GTTGGTAGA-TAAA-------TCTTTCCTTCGAAAATTCCG-----------------AAAGGAT----------------GAAG-AAGAAAGG------TATA-------TATAT-ACG---------TATGGAATATTGTAT-----------------CAAAT-----GATTAATGA-T----GACTCGAATAAAT----CTGTATTTTT-TCTATGA----AAAATGTAAGAATT------AGTGTGAA-----GCGATTCCACATTCAAGAAAAAA-----TCGAATATTCGTTGATCAAATGATTCACTCCATAATCTC-TAGG---TCTTT--TTAAGAACT----ATTAAT-------T-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATACCGACAACAATG-----------------CAATTTATAGT-AAGAGG   
Fagraea_berteroana_AF10219              AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAGTTAAT---------------AT-AAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------CTTTTTCCAAAAACAAAAAGCAAAAAG----------AAAGGCTTAG---------AAAGCAAAAAAAAA-------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAAA-GAAA-------CCTTTGCATCAAAAAATCCG-----------------AAAGTAT----------------AAAG-AAAAAAGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCACAGCCTG-TAGA---TCTTT--TCACGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-A-G??G   
Fagraea_elliptica_AF102420              AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAGTTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------CTTTTTCCAAAAACAAAAAGCAAAAAG----------AAAGGCTTAG---------AAAGAAAAAAAAAAAAAA---AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAAA-GAAA-------CCTTTGCATCAAAAAATACG-----------------AAAGTAT----------------AAAG-AAAAAAGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CTACAGCCTG-TAGA---TCTTT--TCACGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-AAGAGG   
Fagraea_fragrans_AF102421               AATTGGATTGAGTCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAGTTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------CTTTTTCCAAAAACAAAAAGCAAAAAG----------AAAGGCTCAG---------AAAGCAAAAAAAAAAA-----?GG-TAGGTGCAGAGACTCAACGGAAGCT-GT??TAAC-------AAATTGA--------GTTGATAG-C-------GTTGGTARA-RAAA-------CGTTTGCATCAAAATATCCG-----------------AAAGTAT----------------AAAG-AAAAAAGG------TATA-------TACA---------------------GACTGT?T--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCACAGCTTG-TAGA---TCTTT--TCACGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATT?T-A-----   
Faramea_multiflora_AF102422             --------TGGGCCTTGGTATGGAAACCCGCTGAGTGAGAACTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAAGGGGCAATCCTGAGCCAAATCCTGTTTT----------------CCGAAA-------AC----------------AAGTGTTCAT---------AAAGTGAAAAAG---------GGGATAGGTGCAGAGACTCAATGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGGCTG-C-------GGTAGTAGA-GAAG-------TCTTTCCATCAAAAATTCAGTAAGTATTAAAAGTATTAA-GGAT-----------GAAGTGAAG-GATAAACG------TATATACAATATACAT-ACG---------TAGTGAATAGTATAT-----------------TAAAT-----GAGTAATGA-CTAATGAC-AGCCTGAATGAATCTATGTTTTT-TCTATGA---AAAAAC-AAAGAATT------GGTGTGAA-----TAGATTCCACGTTGAAGAAAAAA-----TCTAATATTCATT------------CACTCCATAGTCTGATAGA---TCTTT--TCAACAATTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------TAGAGTCCCATTCTACA-TGCCACTGCTGGCAAAAATG-----------------AAATTTATAGTTAAGAGG   
Faroa_axillaris_AF102423                AATTG-ATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTTT----------TTTTTCAAAAA-------GCAAAAAG----------AAAGTCTCAG---------AAAGCAAAAAAAA--------AGGATAGGTGCAGAGACTCAACGGAAGTT-GTTCTAAC-------AAATGGA--------GTTGATTA-C-------GTTGGTAAA-GAAA-------CCTTTGCATCCAAAATTTCG-----------------AAAGGATAAAAAAGGAT---------------AAGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAT-CCACAGCCTG-TCGA---TCTTT--TCACGAACTG---ATTAAT-------C-GTACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-AAGAGG   
Faroa_schaijesiorum_AF102424            AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTTTT---------TTTTTCAAAA--------GCAAAAAG----------AAAGT?TCAG---------AAAGCAAAAAAAAA-------AGGATAGGTGCAGAGACTCAACGGAAGTT-GTTCTAAC-------AAATGGA--------GTTGATTA-C-------GTTGGTAAA-GAAA-------CCTTTGCATCAAAAATTTCG-----------------AAAGGATAAAAAAGGATAAATAAG-AT-AAGAAAGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAT-CCACAGCCTG-TCGA---TCTTT--TCACGAACTG---ATTAAT-------C-GTACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-AAGAGG   
Frasera_paniculata_AF102425             AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGCTAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTCTTTTTT--------------AAAAAAA------GCAAAAAG----------AAAGGCTCAG---------AAAGAAAA--AGGAAAAA---AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATAGA--------GTTGATTG-C-------ATTGGTAAA-GAAA-------CCTTTTCACCAAAAATTCCG-----------------AAAGGAT----------------GAAA-AAGAAAGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATAATTCAC-CCACAGCCTG-TAGA---TCTTT--TCACGAAATG---ATTAAT-------G-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTATC-TGTCACTGCCGACAACAATG-----------------AAATTTATAGT-GATAGG   
Fraxinus_americana_X76812               --------------------------------AAGTGGTAACTTTCAAATTCAGAGAAACCCCGGAATTAAT---------------AA-AAATGGGCAATCCTGAGCCAAATCCTGTTTT----------------CCCAAA-------AC----------------AAAGGTTCAG---------AAAG-AAAAA-----------AGGATAGGTGCAGAGACTCAATGGAAGCT-GTTCTAAC-------AAATGGA--------GTGGACTG-C-------GTTGGTAGA-GGAA-------TCTTTCCATCGAAACTTCAG-----------------AAAGGAT----------------GAAG-GATAAACG------TATA-------------------------TATTGAATACTATAT-----------------CAAAT-----GATTAATGA-C----GACTCGAATCTCT--ATCTGTATTTTTTTATATGA----AAAATGGAAGAA-T-------------------T-GATTCCACATTGAAGAAAGAA-----TCGAATATTCATTGATCAAATCATTCACTCCATAGTCTGATAGA---TCTTT--TAAAGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------TAGAGTCCCATTCTACA-TGTCAATACCGG-------------------------------------------   
Gardenia_taitensis_AF102426             -ATTGAATTGAGCCTTGGTATGGAAACCCACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAAGGGGCAATTCTGAGCCAAATCCCATTTT----------------CCGAAA-------CC----------------AAAGGT------------------GAAAAA----------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGGCTG-C-------ATTAGTAGA-GAAA-------TCTTTCCATCGAAAATTCCG-----------------AAAGTAT-----------AAAGTGAAG-GATAAACG------TATA-------TA--T-ACG---------TATTGAATACTATAT-----------------CAAAT-----GATTAATGA-C----GACTCGACTGAAT----CTGTATTTTT-TATATGA----AAA-CGGAAGA--------------GAA-----TAGATTCCACATTGAAGAAAGAA-----TCGAATATTCATTGATCAAATGATTCACTCCATAGTCTGATAGA---TCTTT--TCAAGAATTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------TAGAGTCCCGTTCTACA-TGTCAATGTCGGCAACAATG-----------------AAATTTATAGT-AAGAGG   
Gardneria_ovata_AF102427                --------------TTGGTATGGAAACCTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAAAGGGCAATCCTGAGCCAAATCCTGTTTT----------------CCGAAA-------AC----------------AAAGGTTCAG---------AAAGCGAAAAA----------AGGATAGGTGCAGAGACTCAACGGAAGCT-ATTCTAAC-------AAATGGA--------GTTGGCTG-C-------GTTGGTAGA-GAAA-------TCTTTCCATCGAAAATTCAG---------------AAAAATTCA----------GAAGGTGAAG-GATAAACG------TATA-------TACAT-ACG---------TATTTAATACTATATAAAAAT-----------AAAAT-----GATTAATGA-C----GACCCGAATGAAT----CTGTATTT-TTTATATGA----AAAATGGAAGAATT------GGTGTGAA-----TCGATTCCACATTGAAGAAAGAA-----TCGAATATTCATTGATCAAATGATTCCCTCCATAGTCTG-TAGA---TCTTT--TCAAGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------TAGAGTCCCGTTCTACA-TGTCAATGCCGGCAACAATT-----------------AAATTTATAGT-AAGAGG   
Gelsemium_sempervirens_AF102428         AATTGGATTGAGCCTTAGTATGGAAACCTACTAAGTGATAACTTTCAAATTCAGAGAAACCCCGGAATTAAT---------------AA-AAAAGGGCAATCCTGAGCCAAATCCTGTTTT----------------CCGAAA-------AG----------------AAAGGTTCAG---------AAAGGGAAAA-----------GGGATAGGTGCAGAGACTCGATGGAAGTT-GTTCTAAC-------AAATGGA--------GTTGGCTG-T-------GTTGGTAGA-GAAA-------TCTTTCCATCGAAAATCCTG-----------------AAAGGAT----------------GAAG-GATAAACG------TATA-------TACAT-ACG---------TATTGAATACTATAT-----------------CAAAT-----GATTAATAA-T----GACCCGAATGAAT----CTATATTT-TTTATATGA----AAAATGGAAGAATT------AGTGTGAA-----TCGATTCCGCATTGAAGAAAGAA-----TCGAATATTCATTGATCAAATGATTCACTCCACAGTCTG-TAGA---TCTTT--TCAAGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------TAGAGTCCCGTTCTACA-TGTCAATGCCGGCAACAATG-----------------AAATTTTTAGT-AAGAGG   
Geniostemon_gypsophilum_AF102429        AATTGGATTGAGCCTTGGTATGGAAACCTACTGAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AATAAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------------CCAAAA-------ACGAAAAG----------AAAGGCTCAG---------AAAGCAAAAAAAAA-------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGT--A-GA--------------CCATCGAAAATTCCG-----------------AAAGGAT----------------GAAG-AAGAAAGG------TATA-------TACAT-ACG---------GATGGAAGACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCATAGCCTG-TAGA---TCTTT--TCAAGATCTG---ATTAAT-------T-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAAGAATG-----------------AAATTTATAGT-AAGAGG   
Geniostoma_rupestre_AF102430            AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAAAGGGCAATCCTGAGCCAAATCCTATTTT----------------CCGAAA-------AC----------------AAAGGTTCAG---------AAAACGAAAAA----------GGGATAGGTGCAGAGACTCAACGGAAGCT-ATTCTAAC-------AAATGGA--------GTTGGCTG-C-------GTTGGTAGA-GAAA-------TCTTTCCATCGAAAATTCAG-----------------AAAGTAT----------------GAAG-GATAAACG------TATA-------TACAT-ACG---------TATTTAATACTATAT-----------------CAAAT-----GATTAATGA-C----GACACGAATGAAT----CTGTATTTTT-TATATGA----AAAATGCAAGAATT------GGTGTGAA-----TCGATTCCACATTGAAGAAAGAA-----TCGAATATTCATTGATCAAATGATTCACTCCATAGTCTG-TAGA---TCTTT--TCAAGAACTG---ATTAAT-------T-GGACGA-GAA-TAAAGA-------TAGAGTCCCGTTCTACA-TGTCAATGTCGGCAACAATG-----------------AAATTTATAGT-AAGAGG   
Gentianella_anisodonta_X77870           AATTGGATTGAGCCTTGGTATGGAAACCTGCTAAGTGCTAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAG-GGGCAATCCTGAGCCAAATCCTATTAAA-------------ATCAAAAAAA-----GCAAAAAG----------AAAGGCTCAG---------AAAGAAAAAA-----------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAAA-GAAA-------CCTTTTCACCAAAAATTCCG-----------------AAAGGAT----------------GAAA-AAGAAAGG------TATA-------TACA---------------------AACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCACAGCCTG-TGGA---TCTTT--TCACGAAATG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-GAGAGG   
Gentianella_aurea_AF102431              AATTGGATTGAGCCTTGGTATGGAAACCTGCTAAGTGCTAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAG-GGGCAATCCTGAGCCAAATCCTATTCAATATAAATCTTAAAA-CAAAAAAA-----GCAAAAAG----------AAAGGCTCAG---------AAAGAAAAA------------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAAA-GAAA-------CCTTTTCACCAAAAATTCCG-----------------AAAGGAT----------------GAAA-AAGAAAGG------TATA-------TGCA---------------------AACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCACAGCCTG-TGGA---TCTTT--TCACGAAATG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-GAGAGG   
Gentianella_germanica_X77885            AATTGGATTGAGCCTTGGTATGGAAACCTGCTAAGTGCTAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAG-GGGCAATCCTGAGCCAAATCCTATTAAATATGAA------AATCAAAAAAA-----GCAAAAAG----------AAAGGCTCAG---------AAAGAAAAAA-----------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAAA-GAAA-------CCTTTTCACCAAAAATTCCG-----------------AAAGGAT----------------GAAA-AAGAAAGG------TATA-------TACA---------------------AACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCACAGCCTG-TGGA---TCTTT--TCACGAAATG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTATGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-GAGAGG   
Gentianella_peruviana_AF102432          AATTGGATTGAGCCTTGGTATGGAAACCTGCTAAGTGCTAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAG-GGGCAATCCTGAGCCAAATCCTATTAAA-------------ATCAAAAAAA-----GCAAAAAG----------AAAGGCTCAG---------AAAGAAAAAA-----------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAAA-GAAA-------CCTTTTCACCAAAAATTCCG-----------------AAAGGAT----------------GAAA-AAGAAAGG------TATA-------TACA---------------------AACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCACAGCCTG-TGGA---TCTTT--TCACGAAATG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-GAGAGG   
Gentianopsis_crinita_AF102433           AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGCTAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAACCCTGAGCCAAATCCTA--AAA---------------AAAAAAA------GCAAAAAA--AAAAG---AAAGGCTCA?---------AAAGAAAAAA-----------AGGATAGGTGCAGAGACTCAATGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGGAAA-GAAA-------CCTTTTCACCAAAAATTCCG-----------------AA?GGAT----------------GAAG-AATAAAGG------TATA-------TATA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCACAGCCTG-TAGA---TCTTT--TCACGAAATG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-GAAAGG   
Gentiana_acaulis_X77869                 AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------------CGAAAAA------GCAAAAAG----------AAAGGCTTAG---------AAAGAAATAA-----------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAA-GGA--------GTTGGTTG-C-------GTTGGTAAA-GAAA-------TCTTTCTACCAAAAATTCCA-----------------AAAGGAT----------------GAAG-AAGAGGGG------T-----------------------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAACGATTCGC-CCACAGCCTG-TAGA---TC----------AACGG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCATTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTGATAGT-AAGAGG   
Gentiana_alpina_X77868                  AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTTT----------------GAAAAA------GCAAAAAG----------AAAGGCTTAG---------AAAGAAATAA-----------AGGATAGGTGCAGAGACTCAACGGAAGCT-ATTCTAAC-------AAATGGA--------GTTGGTTG-C-------GTTGGTAAA-GAAA-------CCTTTCTACCAAAAATTCCA-----------------AAAGGAT----------------GAAG-AAGAGGGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAACGATTCAC-CCACAGCCTG-TAGA---TCTTT--TCACGAACGG---ATTAAT-------C-GGACGAAGA--TAAAGA-------GAGAGTCCCATTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-AAGAGG   
Gentiana_asclepiadea_X77871             AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------------CGAAAAA------GCAAAAAG----------AAAGGCTTAGAAAGAAATGAAAGAAATAA-----------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGGTTG-C-------GTTGGCAAA-GAAA-------CCTTTC-ACCAAAAATTCCA-----------------AAAGG------------------GAAG-AAGAGGGG------TATA-------TA-----------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAACGATTCAC-CCACAGCCTG-TAGA---TCTTT--TCACGAACGG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCATTCTGCAGTGTCAATGCAGACAACAATG-----------------AAATTTAGAGT-AAGAGG   
Gentiana_bavarica_X77873                AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTAGTTTT---------------CGAAAAA------GCAAAAAG----------AAAGGCTTAGAAAGAAATGAAAGAAATAA-----------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAAA-GAAA-------CCTTTCTACCAAAAATTCCA-----------------AAAGGAT-----------------------GAGGGG------TATA-------TACA---------------------GACTGAAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCACAACCTG-CAGA---TCTTT--TCACGAACGG---ATTAAT-------C-TGACGA-GAA-TAAAGA-------GAGAGTCCCATTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-AAGAGG   
Gentiana_clusii_X77879                  AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTTT----------------GAAAAA------GCAAAAAG----------AAAGGATTAG---------AAAGAAATAA-----------AGGATAGGTGCAGAGACTCAACGGAAGCT-ATTCTAAC-------AAATGGA--------GTTGGTTG-C-------GTTGGTAAA-GAAA-------CCTTTCT-CCAAAAATTCCA-----------------AAAGGAT----------------GAAG-AAGAGGGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAACGATTCAC-CCACAGCCTG-TAGA---TCTTT--TCACGA-CGG---ATAAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCATTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-AAGAGG   
Gentiana_cruciata_X77880                AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------------CGAAAAA------GCAAAAAG----------AAAGGCTTAG---------AAAGAAATAA-----------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGGTTG-C-------GTTGGTAAA-GAAA-------CCTTTCTACCAAAAATCCCA-----------------AAAGGAT----------------GAAG-AAGAGGGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAACGATTCAC-CCACATCCTG-TAGA---TCTTT--TCACGAACGG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-AACAGG   
Gentiana_cruciata_AF102434              AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------------CGAAAAA------GCAAAAAG----------AAAGGCTTAG---------AAAGAAATAA-----------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGGTTG-C-------GTTGGTAAA-GAAA-------CCTTTCTACCAAAAATCCCA-----------------AAAGGAT----------------GAAG-AAGAGGGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAACGATTCAC-CCACAGCCTG-TAGA---TCTTT--TCACGAACGG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-AAGAGG   
Gentiana_frigida_AF102435               AATTGGATTGAGCCTTGGTATGGAAACTTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATATTTT--------------CAAAAAA------GCAAAAAGG---------AAAGGCTTAG-------T-AAAGAAATAA-----------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAAA-GAAA------TCTTTACTACCAAAAATTCCAT----------------AAAGGAT----------------GAAG-AAGAGGGT------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTAAC-CCACAGCCTG-TAGA---TCTTT--TCACGAACGG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGTTGACAACAATG-----------------AAATTTATAGT-AAGAGG   
Gentiana_froelichii_X77884              AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------------CGAAAAA------GCAAAAAG----------AAAGGCTTAGAAAGAAATGAAAGAAATAA-----------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGGTTG-C-------GCTGGTAAA-GAAA-------CCTTTCTACCAAAAATTCCA-----------------AAAGGAT----------------GAAG-AAGAGGGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------GAAACGATTCAC-CCACAGCCTG-TAGA---TCTTT--TCACGAACGG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCATTCTGCA-TGTCAATGCAGACAACAATG-----------------AAATTTAGAGT-AAGAGG   
Gentiana_lutea_X75702                   -ATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------------CGAAAAA------GCAAAAAG----------AAAGGCTTAGAAAGAAATGAAAGAAATAA-----------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAA-G-A--------GTTGGTTG-C-------GTTGGTAAA-GAAA-------CCTTTCTACCAAAAATTCCA-----------------AAAGGAT----------------GAAG-AAGAGGGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAACGATTCAC-CCACAGCCTG-TAGA---TCTTT--TCACGAACGG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCATTCTGCA-TGTCAATGCAGACAACAATG-----------------AAATTTATAGT-AAGAGG   
Gentiana_punctata_X77894                AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------------CGAAAAA------GCAAAAAG----------AAAGGCTTAGAAAGAAATGAAAGAAATAA-----------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGGTTG-C-------GTTGGTAAA-GAAA-------CCTTTCTACCAAAAATTCCA-----------------AAAGGA-----------------GAAG-AAGAGGGG------TATA-------TACA---------------------GACTGTCT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAACACATTCAC-CCACAGCCTG-TAGA---TCTTT--TCACGAACGG---ATTAAT-------C--GACGA-GAA-TAAAGA-------GAGAGTCCCATTCTGCA-TGTCAATGCAGACAACAATG-----------------AAATTTATAGT-AAGAGG   
Gentiana_purpurea_X77893                AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------------CGAAAAA------GCAAAAAG----------AAAGGCTTAGAAAGAAATGAAAGAAATAA-----------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGGTTG-C-------GTTGGTAAA-GAAA-------CCTTTGTACCAAAAATTCCA-----------------AAAGGAT----------------GAAG-AAGAGGGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAACGATTCAC-CCACAGCCTG-TAGA---TCTTT--TCACGAACGG---ATTAA--------C--GACGA-GAA-TAAAGA-------GAGAGTCCCATTATGCA-TGTCAATGCAGACAACAATG-----------------AAATTTATAGT-AAGAGG   
Gentiana_pyrenaica_X77895               AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCTTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTTTT---------------GAAAAA------GCAAAAAAAAGAAAGGCTTAAGGCTTAG----AAATGA-AG---TAA-----------GTGATAGGTGCAGAGACTCAATGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGGT-----------------------------------------------------------------------------------------------G-AAGAGGGA------TATA-------TACA---------------------GAGTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAACGATTCAC-GCGCAGCCTG-TAGA---TCTTT--TCACGAACGT---ATTAAT-------C-GGACTA-GAA-TAAAGA-------GAGAGTCCCGTTATGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-AAGAGG   
Gentiana_sedifolia_AF102436             AATTGGATTGAGCCTTGGTATGGAAAACTACTAAGTGATAATTTTCAAATTCAGAGAAACCTTGGAATTAAT---------------AA-AAA-GGGCAATCCTGGGCCAAATCCTATTTTT----------------GAAAAA------GTAAAAAAAAAAAAG---AAAGGCTTAA---------AAAGAAATAA-----------AGGATAGGTGCAGAGACTCAATGGAAGCT-GTTCTAAC-------AAATCGA--------GTTGGT-----------------------------------------------------------------------------------------------G-AAGAGGGG------TATA-------TACA---------------------GAGTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAACGATTCAT-CCACAGCGTG-TAGA---TTTTT--TCACGAACAA---ATTAAT-------C-GGATTA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-AAGAGG   
Gentiana_terglouensis_X77897            AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTAGTTTT---------------CGAAAAA------GCAAAAAG----------AAAGGCTTAGAAAGAAATGAAAGAAATAA-----------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAAA-GAAA-------CCTTTCTACCAAAAATTCCA-----------------AAAGGAT----------------GAGG-AAG-GGGG------TATA-------TACA---------------------GACTGAAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCACAACCTG-CAGA---TCTTT--TCACGAACGG---ATTAAT-------CAGGACGA-GAA-TAAAGA-------GAGAGTCCCATTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-AAGAGG   
Gentiana_utriculosa_X77898              AATTGGATTGAGCCTTGGTATGGAAACCTATTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTAGTTTT---------------CGAAAAA------GCAAAAAG----------AAAGGCTTAGAAAGAAATGAAAGAAATAA-----------AGGATAGGTGCAGAGACTCAACGAAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAAA-GAAA-------CCTTTCT-CCAAAAATTCCA----------------AAAGGGAT----------------GAGG-AAGAGGGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCACAACCTG-CAGA---TCTTT--TCACGAACGG---ATTAAT-------CA-GACGA-GAA-TAAAGA-------GAGAGTCCCATTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-AAGAGG   
Gentiana_verna_X75704                   AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTAGTTTT---------------CGAAAAA------GCAAAAAG----------AAAGGCTTAGAAAGAAATGAAAGAAATAA-----------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAAA-GAAA-------CCTTTCTAC-AAAAATTCCA-----------------AAAGG-T----------------GAGG-AAAAGGGG------TATA-------TACA---------------------GACTGAAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCACAACCTG-CAGA---TCTTT--TCACGAACGG----TTAAT-------CA-G-CGA-GAAATAAAGA-------GAGAGTCCCATTCTGCAGTGTCAATGCCGACAACAATG-----------------AAATTTATAGT-AAGAGG   
Halenia_palmeri_AF102437                AATTGGATTGAGCCTTGGTATGGATACCTACTAAGTGCTAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTGTTTTT---------------AAAAAAA------G--AAAAG----------AAAGGCTCAG---------AAAGAAAAAA-----------GGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAAA-GAAA-------CCTTTTCACCAAAAATTCCG-----------------AAAGGAT----------------GAAA-AAGAAAGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCACAGCCTG-TAGA---TCTTT--TCACGAAATG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-GAGAGG   
Halenia_sp_AF102438                     AATTGGATTGAGCCTTGGTATGGATACCTACTAAGTGCTAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTGTTTTT---------------AAAAAAA------G--AAAAG----------AAAGGCTCAG---------AAAGAAAAAA-----------GGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAAA-GAAA-------CCTTTTCACCAAAAATTCCG-----------------AAAGGAT----------------GAAA-AAGAAAGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCACAGCCTG-TAGA---TCTTT--TCACGAAATG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-GAGAGG   
Hamelia_papillosa_AF102439              --------------TTGGTATGGAAACCCACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAGGGGGCAATCCTGAGCCAAATCCTGTTTT----------------CCCGAA-------AC----------------AACGGTTCAG---------AAAGTGAAAAA----------GGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGGCTG-C-------GTTAGTAGA-GAAA-------TCTTTCCATCGAAAATTCAG-----------------AAAGAAT-----------GAAGTGAAG-GATAAACG------TATA-------TACAT-ACG---------TATTGAATACTATAT-----------------CAAAT-----GATTCATGA-C----GACCCGACTGAAT----CCGTATTTTTATAGATGA----AAAACGGAAGAATT------GGTGTGAA-----TAGATTCCACATTGAAGAAAGAA-----TCGAATATTCATCGATCAAACGATTCACTCCATGGTCTGATAGA---TCTTT--TCAAGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------TAGAGTCCCGTTCTACA-TGTCAATGCCGGCAACAATG-----------------AAATTTATAGT-AAGAGG   
Hoppea_dichotoma_AF102440               AATTGGATTGAGCCTTGGTATGGAAACCTACTGAGTGATAATTTTCAAATTCAGCGAAACTCTGGAATTAAA---------------AAAAAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------------CAAAAA-------AGAAAAAT----------AAAGGCACAG---------AAATAAAAAAA----------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-CATTGGT-GTTGGTAGA-GAAA-------TATTTCCATAGAAAATTCCG-----------------AACGGAT----------------AAAT-AAGAAAGG------TATA-------TACAT-ACG---------TATGGAAAACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAGTGATTCAC-CCATAGGTTG-TAGA---TCTTT--TCAAGAATTG---ATTAAT-------C-GGACGA-GAA-TTAAGA-------GAGAGTCCCGTTCTACA-TGTCAATGCTGACAATAATG-----------------AAATTTATAGT-AAGAGG   
Hydrangea_paniculata_X85796             ------------CCTTGGTATGGAAACCTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------CA-AAATGGGCAATCCTGAGCCAAATCCTGTTTT----------------CCGAAA-------ACAAAC------------AAAAGTTCAG---------AAAGCGAAAATCAAAA-A---AGGATAGGTGCAGAGACTCAATGGAAGCTTATTCTAAC-------AAATGGA--------GTTGACTG-CCTTGC--GTTGGTAGA-GGAA-------TCCTTTCATCGAAACTTCAG-----------------AAAGGAT----------------GAAG--ATAAACC------TATATAC---ATACGTTACG----------ACTGAATATTATAT-----------------CAA-T-----GATTAATGA-C----GACCCGAATCTGT--ATCCGTATTTTT-GATATGA----AAAATGGAAGAATT------GTTGTAAA-----TCGATTCCAAATTGAAGAAAGAA-----TCGAATATTCATTGATCAAATCATTCACTCCATAG?CTG?TAG?TCCTTTTT?TTGAAGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------TAGAGTCCCGTTCTACA-TGTCAATACCGAC??C?ATG-----------------AAA?T???AGT-AAGAGG   
Irlbachia_poeppigii_AF102441            AATTGGATTGAGCCTTGGTATGGAAACCTAATAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------AATAATAA-AAA-GGGCAATTCTGAGCCAAATCCTATTTTTTTT------CTTTTTCAAAAA-------GCAAAAAG----------AAAGGCTCAG---------AAAGCAAAAAAAAAGGGAA--AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGGAAA-GAAA-------CCTTTCCATCAAAAATTCCG-----------------AAAGGAT----------------GAAG-AAGAGAGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CTCCAGCCTG-TAGA---TCTTT--TCACGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-AGAGGA   
Irlbachia_pratensis_AF102442            AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------AATAAAAA-AAA-GGGCAATTCTGAGCCAAATCCTATTTTTT--------CTTTTTCAAAAA-------GCAAAAAG----------AAAGGCTCAG---------AAAGCAAAACAAAAAAAAA--AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGGAAA-GAAA-------CCCTTCCATCAAAAATTCCG-----------------AAAGGAT----------------GAAG-AAGAAAGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCCCAGCCTG-TAGA---TCTTT--TCACGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-AAGAGG   
Ixanthus_viscosus_AF102443              ??TTGGATTGAGCCTTGGTATGGAAACCTACTGAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AATAAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------------CCAAAA-------AG-AAAAG----------AGAGGCTAAG---------AAAGCAAAAAAAAAA------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAGA-GAAA-------TAGTTCCATCGAAAATTCCG-----------------AAAAGAT----------------GAAG-AAGAAAGG------TATA-------TACAT-ACG---------GATGGAAGACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAAAGATTCAC-CCATAGCCTG-TAGA---TCTTT--TCAAGATCTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTT?TGCA-TGTCAATGCCGACAAGAATG-----------------AAATTTATAGT-AAGAGG   
Jaeschkea_oligosperma_AF102444          AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGCTAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAG-GGGCAATCCTGAGCCAAATCCTATTAAA-ATGAA----------AAAAAAA-----GCAAAAAG----------AAAGGCTCAG---------AAAGAAAAAA-----------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAAA-GAAA-------CCTTTTCACCAAAAATTCCG-----------------AAAGGAT----------------GAAA-AAGAAAGG------TATA-------TACG---------------------AACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCACAGCCTG-TGGA---TCTTT--TCACGAAATG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCATTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-GAGAGG   
Jasminum_fluminense_AF102445            ----GGATTGAGCCTTGGTATGGAAACCTACTAAGTGGTAACTTTCAAATTCAGAGAAACCCCGGAATTAAT---------------AA-AAATGGGCAATCCTGAGCCAAATCCTGTTTT----------------CCCCAA-------AC----------------AAGAGTTCAG---------AAAGAAAAAA-----------GGGATAGGTGCAGAGACTCAATGGAAGCT-GTTCTAAC-------AAATGGA--------GTGGACTA-G-------GTTGGTAGA-GGAA-------TCTTTCCATCGAAACTTCAG-----------------AAAGGAT----------------GAAG-GATAAATAG-----TATA-------------------------TATTTTTTACTATAT-----------------CAAAT-----GATTAATGA-C----GACTCGAATCTCT--ATCTGTATTTTTTTATATGA----AAAATGGAAGA-TT-------------------T--ATTCCATTTTGAAGAAAGAA-----TCGAATATTCATTGATCAAATCATTCACTCCACAATCTGATAGA---TCTTT--TAAAGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------TAGAGTCCCATTCTACA-TGTCAATACCGGCAACAATG-----------------AAATTTATAGT-AAAAGG   
Labordia_sp_AF102446                    AATT???TTGAGCCTTGGGATGGAAACCTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAAAGGGCAATCCTGAGCCAAATCCTATTTT----------------CCGAAA-------AC----------------AAAGGGTCAG---------ARAACGAAAAA----------GGGATAGGTGCAGAGACTCAACGGAAGCT-ATTCTAAC-------AAATGGA--------GTTGGCTG-C-------GTTGGTAGA-GAAA-------TCTTTCCATCTAAAATTTAG-----------------AAAGTCT----------------GAAG-GATAAACG------TATA-------TACAT-ACG---------TATTTAATACTATAT-----------------CAAAT-----GATTAATGA-C----GACACGAATGAAT----CTGTATTTTTTTATATGA----AAAATGCAAGAATT------GGTGTGAA-----TCGATTCCACATTGAAGAAAGAA-----TCGAATATTCATTGATCAAATGATTCACTCCATAGTCTG-TAGA---TCTTT--TAAAGAACGG---ATTAAT-------T-GGACGA-GAA-TAAAGA-------TAGAGTCCCGTTCTACA-TGTCAATGTCGGCAACAATG-----------------AAATTTATAGT-AAGAGG   
Labordia_tinifolia_AF102447             AATTGGCTTGAGCCTTGGTATGGAAACCTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAAAGGGCAATCCTGAGCCAAATCCTATTTT----------------CCGAAA-------AC----------------AAAGGGTCAG---------AAAACGAAAAA----------GGGATAGGTGCAGAGACTCAACGGAAGCT-ATTCTAAC-------AAATGGA--------GTTGGCTG-C-------GTTGGTAGA-GAAA-------TCTTTCCATCTAAAATTTAG-----------------AAAGTCT----------------GAAG-GATAAACG------TATA-------TACAT-ACG---------TATTTAATACTATAT-----------------CAAAT-----GATTAATGA-C----GACACGAATGAAT----CTGTATTTTTTTATATGA----AAAATGCAAGAATT------GGTGTGAA-----TCGATTCCACATTGAAGAAAGAA-----TCGAATATTCATTGATCAAATGATTCACTCCATAGTCTG-TAGA---TCTTT--TCAAGAACTG---ATTAAT-------T-GGACGA-GAA-TAAAGA-------TAGAGTCCCGTTCTACA-TGTCAATGTCGGCAACAATG-----------------AAATTTATAGT-AAGAGG   
Lisianthius_jefensis_AF102448           AATTGGATTGAGCCTTGGTATGGATACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AATAAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------------ACAAAAACAAAAAGCAAA-----------------GCTCAG---------AAAGAAAAAAAAAAAAAAA--AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AACTGGA--------GTTGATTG-C-------GTTGGTAAA-GAAA-------CCTTTGCATCAAAAATTCCG-----------------AAAGGAT----------------AAAG-AAGAAAGG------TATA-------TATA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCACAGCCTG-TAGA---TCTTT--TCACGAACTG---ATTAAT-------C-GTACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAA-G-----------------AAATTAATAGT-AAGAGG   
Lisianthius_laxiflorus_AF102449         ??TTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------------ACAAAAACAAAAAGCAAA-----------------GCTCAG---------AAAGAAAAAAAAAAAAAA---AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AACTGGA--------GTTGATTG-C-------GTTGGTAAA-GAAA-------CCTTTGCATCAAAAATTCCG-----------------AAAGGAT----------------AAAG-AAGAAAGG------TATA-------TATA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCACAGCCTG-TAGA---TCTTT--TCATGAACTG---ATTAAT-------C-GTACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAA-G-----------------AAATTTATAGT-AAGAGG   
Lisianthius_longifolius_AF102450        --???GATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------------ACAAAAACAAAGAGCAAA-----------------GCTCAG---------AAAGAAAAAAAAAAAAAA---AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AACTGGA--------GTTGATTG-C-------GTTGGTAAA-GAAA-------CCTTTGCATCAAAAATTCCG-----------------AAAGGAT----------------AAAG-AAGAAAGG------TATA-------TATA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCACAGCCTG-TAGA---TCTTT--TCACGAACTG---ATTAAT-------C-GTACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAA-G-----------------AAATTTATAGT-AAGAGG   
Logania_albiflora_AF102451              --TT-GATTGAGCCTTGGTATGGAAACCTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAAAGGGCAATCCTGAGCCAAATCCTATTTT----------------CCGAAA-------AC----------------AAAGGTTCAG---------AAAGCGAAAAA----------GGGATAGGTGCAGAGACTCAACGGAAGCT-ATTCTAAC-------AAATGGA--------GTTGGCTG-C-------GTTGGTA?A-GAAA-------TCTTTCCATCGAAAATTCAG----------------------------------------ACAG-GATAAACG------TATA-------TACGT-ACG---------TATTTAATACTATAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCACTCCATAGTCTG-TAGA---TCTTT--TCAAGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------TAGAGTCCCGTTCTACA-TGTCAATGCCGGCAACAATG-----------------AAATTTATAGT-AAGAGG   
Lomatogonium_carinthiacum_X77899        AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGCTAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAG-GGGCAATCCTGAGCCAAATCCTAT--------------------AAAAAA------G-AAAAAG----------AAAGGCTCAG---------AAAGAAAAAAA----------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAAA-GAAA-------CCTTTTCACCAAAAATTCCG-----------------AAAGGAT----------------GAAA-AAGAAAGG------TATA-------TACA---------------------AACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCACATCCTG-TCTA---TCTTT--TCACGAAATGTTTGTTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCCTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTAGAGT-GAGAGG   
Lomatogonium_oreocharis_AF102452        AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGCTAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAG-GGGCAATCCTGAGCCAAATCCTAT-AA----------------AAAAAAA------GCAAAAAG---------TAAAGGCTCAG---------AAAGAAAAAA-----------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTGGC-------GTTGGTAAA-GAAA-------CCTTTTCACCAAAAATTCCG-----------------AAAGGAT--GAAAGGAT------GAAA-AAGAAAGG------TATA-------TACA---------------------AACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAACGATTCAC-CCACAGCCTG-TGGA---TCTTT--TCGCGAAATG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-GAGAGG   
Luculia_gratissima_x_tsetensis_AF102453 -ATTGGATTGAGCCTTGGTATGGAAACCCACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAAGGGGCAATCCTGAGCCAAATCCTGTTTT----------------CCGAAA-------AC----------------AAAGGTTCAG---------AAAGTGAAAAA----------AGGATAGGTGCAGAGACTCAATGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGGCTG-C-------GTTAGTAGA-GAAA-------TCTTTCCATCGAAAATTTAG-----------------AAAGGAC-----------GAAGTGAAG-GATAAACG------TATA-------TACAT-ACG---------TATTGAATACTATAT-----------------CAAAT-----GATTAATGA-C----GACCCAAATGAAT----CTGTATTTTTTTATATGA----AAAACGGAAGAATT------AGTGTGAA-----TAGATTCCACATTGAAGAAAGAA-----TCGAATATTCATTGATCAAATGATTCACTCCATAGTCTGATAGA---TCTTT--TCAAGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------TAGAGTCCCGTTCTACA-TGCCAATGCCGGCAACAATG-----------------AAATTTATAGT-AAGAGG   
Macrocarpaea_domingensis_AF102454       AATTGGATTGAGCCTTGGTATGGAAACC?ACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAATAATA--AATAATAATAA-AAA-GGGCAATTCTGAGCCAAATCCTATTTTTT--------ATTTTTCAAAAA-------GCAAAAAA----------------------------------AAAAAA----------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGGAAA-GAAA-------CCTTTCCATCAAAAATTCCA-----------------AAAGGAT----------------GAAG-AAGAAAGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-GCCCAGCCTG-TAGA---TCTTT--TCACGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-AAGAGG   
Macrocarpaea_cf_glabra_AF102455         AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAATAATA--AATAATAAGAA-AAA-GGGCAATTCTGAGCCAAATCCTATTTTTG--------CTTTTTCAAAAA-------GCAAAAAA----------------------------------AAAA------------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGGAAA-GAAA-------CCTTTCCATCAAAAATTCCA-----------------AAAGGAT----------------GAAG-AAGAAAGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-GCCCAGCCTG-TAGA---TCTTT--TCACGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGA?TCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-AAGAGG   
Macrocarpea_valerii_AF102456            AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAATAATA--AATAATAATAA-AAA-GGGCAATTCTGAGCCAAATCCTATTTTTG--------CTTTTTCAAAAA-------GCAAAAAA----------------------------------AA--------------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGGAAA-GAAA-------CCTTTCCATCAAAAATTCCA-----------------AAAGGAT----------------GAAG-AAGAAAGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-GCCCAGCCTG-TAGA---TCTTT--TCACGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-AAGAGG   
Macrocarpaea_rubra_AF102457             ??TTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------AATAATAA-AAA-GGGCAATTCTGAGCCAAATCCTATTTTT?--------CTTTTTCAAAAA-------GCAAAAAG----------AAAGGCTCAG---------AAAGCAAAAAAAA--------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGGAAA-GAAA-------CCTTTCCATCAAAAATTCCA-----------------AAAGGAT----------------GAAG-AAGAAAGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-GCCCAGCCTG-TAGA---TCTTT--TCACGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-AAGAGG   
Megacodon_stylophorus_AF102458          AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGCTAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------------CAAAAAA------GCAAAAAG----------AAAAGCTCAG---------AAAGAAAAAA-----------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAAA-GAAA-------CCTTTTCACCAAAAATTCCG-----------------AAAGGAT----------------GAAA-AAGAAAGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCACAGCCTG-TAGA---TCTTT--TCACGAAATG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-GAGAGG   
Mitrasacme_pilosa_AF102459              --TTGGATTGAGCCTTGGTATGGAA-CCTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAGT---------------AA-AAAAGGGCAATCCTGAGCCAAATCCTATTTT----------------CCGAAA-------AC----------------AAAGGTTCAG---------AAAACGAAAAA----------CGGATAGGTGCAGAGACTCAACGGAAGCT-ATTCTAAC-------AAATGGA--------GGTGGCTG-C-------GTTGGTAGA-GCAA-------TCTTTCCATCAAAAATTCAG-----------------AAAGTAT----------------GAAG-GATAAACG------TATA-------TACAT-ACGTATTTTACGTATTTAATACTATATCACATTTTTAATGATATCAAAT-----GATTAATGA-C----GACACAAATGAAT----CTGTATTT-TTTATATGA----AAAATGCAAGAATT------GGTGTTAATTGAATGGATTCTACATTGAAGAAAGAA-----TCGAATAGTCATTGATCAAATGATTCACTCCATAGTCTG-TCGA---TCTTT--TCAAGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------TAGAGTCCCGTTCTACA-TGTCAATGCCGGCAACAATG-----------------AAATTTATAGT-AAGAGG   
Mitreola_petiolata_AF102460             AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAAAGGGCAATCCTGAGCCAAATCCTATTTT----------------CCGAAA-------AC----------------AAA----------------GA-GCGAAAAA----------GGGATAGGTGCAGAGACTCAACGGAAGCT-ATTCTAAC-------AAATGGA--------GTTGGCTG-C-------GTTGGTAGA-GAAA-------TCTTTCCATCGAAAATTCAG-----------------AAAGGAT----------------GAAG-GATAAACG------TCTA-------TACAT-ACG---------TATTTAATACTATAC-----------T-ATATCAAAT-----GATTAATGA-C----GATCCGAATGAAT----CTGTATTT--TTATATGA----AAAATGCAAGAATT------GGTGTGAA-----TCGATTCCACATTGAAGAAAGAA-----TCGAATATTCATTGATCAAATGATTGACTCCATAGTCTG-TAGA---TCTTT--TCAAGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------TAGAGTCCCGTTCTACA-TGTCAATGCCGGCAACAATG-----------------AAATTTATAGT-AAGAGG   
Neblinantha_parvifolia_AF102461         AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------AATAATAA-AAA-GGGCAATTCTGAGCCAAATCCTATTTTTG--------CTTTTTCAAAAA-------GCAAAAAG----------AAAGGCTCAG---------AAAGCAAAAAAAA--------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGGAAA-GAAA-------CCTTTCCATCAATAATTCCG-----------------AAAGGAT----------------GAAG-AAGAAAGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCCCAGCCTG-TAGA---TCTTT--TCACGAACTG---ATTAAT-CGTAATC-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-AAGAGG   
Neuburgia_corynocarpa_AF102462          AATTGTATTGAGCCTTGGTATGGAAACCTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAAAGGGCAATCCTGAGCCAAATCCTGTTTT----------------CCGAAA-------AC----------------AAAGGTTCAG---------AAAACAAAAAA----------AGGATAGGTGCAGAGACTCAACGGAAGCT-ATTCTAAC-------AAATGGA--------GTTGGCTG-C-------GTTAA----------------TCTTTCCATCGAAAATTCAG-----------------AAAGGAT----------------GAAG-GATAAACG------TATA-------TACAT-ACG---------TATTTAATACTATAT-----------------CAAAT-----GATTAATGA-C----GACCCGAATGAAT----CTGTATTT-TTTATATGA----AAAATGGAAGAATT------GGTGTGAA-----TCGATTCCACAA--------GAA-----TCGAATATTCATTGATCAAATTATTCACTCCATAGTCTG-TAGA---TCTTT--TCAAGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------TAGAGTCCCGTTCTACA-TGTCAATGCCGGCAACAATG-----------------AAATTTATAGT??AGAGG   
Neurotheca_loeselioides_AF102463        AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTTTTTTTTTT------C--TTTCGAGA--CTTTTTTCTTTTTG-------------GTTTTGG---------AAA--AAAAAA----------AGGATAGGTGCAGAGACTCAACGGAAGTT-GTTCAAAC-------AAATGGA--------GTTGATTA-C-------GTTGGTAAA-GAAA-------CCTTTACATCAAAAATTTCG-----------------AAAGGAT---AAAGAA-------AAAG-AAGAAAGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAT-CCATAGCCTA-TCGA---TCTTT--TCACGAACTG---AGTAAT-------C-GTACGA-GAA-GAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-AAGAGG   
Obolaria_virginica_AF102464             AATTGGATTGAGCCTTGGTATGGAAACCTAATAAGTTATAATTTTCAAATTCAGAGAAACCCCGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------------CAAAAAA------GCAAAAAAG---------AAAGGCTCAG---------AAAGAAAA-AAGGAAA-----AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTA-C-------ATTGGTAAA-GAAA-------CCCTTTCACCAAAAATTCCG-----------------AAAGGAT----------------GAAG-AATAAGGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCACAGCCTG-TAGA---TCTTT--TCACGAAATG---ATTAAT-------A-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-GAGAGG   
Ornichia_madagascariensis_AF102465      AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAACTTTCCAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTT------------TTTTCCGAAA-------AG----------------AACGGGTCAG---------AAAGCAAAAAAA---------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA-------------------------GTTGGTAGA-TAAA-------TCTTTCCCTCAAAAATT-AG--------------AATAAAGGAT----------------GAAG-AAGAGAGG------TATA-------TACAT-ACG---------TATGGAATATTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCACTCCATAGCCTG-TAGG---TCTTT--TTAAGAACT----ATTAAT-------T-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATACCGACAACAATG-----------------CAATTTATAGT-AAGAGG   
Orphium_frutescens_AF102466             AATTGGATTGAGCCTTGGTATGGAAACCTACTGAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AAAAAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------------CCAAAA-------ACAAAAAGCAAAAAG---AAAGGCTCAG---------AAAGCAAAAAAAA--------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAGA-TAAA-------TATTTCCATCGAAAATTCCG-----------------AAAGGAT----------------GAAG-AAGAAAGG------TATA-------TACAT-ACG---------GATGGAAGACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCATAGCCTG-TAGA---TCTTT--TCAAGATCTG---ATTAAT-------C-AGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAAGAATG-----------------AAATTTATAGT-AAGAGG   
Pauridiantha_sp_AF102467                -ATTGGATTGAGCCTTGGTATGGAAACCCACTGAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAAGGGGTAATCCTGAGCCAAATCCTGTTTT----------------CCGAAA-------AC----------------AAAGATTCAG---------AAAGTGAAAAAG---------GGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGGTTG-C-------GGTAGTAGA-GAAA-------TCTTTCCATCAAAAAT-CAG--------------AT--AAGGAT-----------GAAGTGAAG-GATAAACG------TATA-------TACAT-ACG---------TATTGAATACTATAT-----------------TAAAT-----GAGTAATGA-G----AGCCCGAATGAAT----ATATATATTT-TCTATGA----AAAACGAAAGAATT------GGTGTGAA-----TAGATTCCGCGTTGAAGAAAGAA-----TCGAATATTCATTGATCAAATGATTCACTCCATAGTCTGATAGA---TCTTT--TTAAGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------TAGAGTCCCATTCTACA-TGTCAATGCCGGCAACAATG-----------------AAATTTATAGTTAAGAGG   
Periploca_graeca_AF102468               AATTGGATTGAGCCTTGGTAAGGAAACCTACTAAGTGATGACTTTCAAATTCAGAGAAACCCCGGAATTAAG---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTT----------------ACACAA-------AC----------------AAAGGTTCAG---------AAAACGAAAACA---------AGGATAGGTGCAGAGACTCGACGGAAGAT-GTTCTAAC-------AAATGGA--------GGTGGCCA-C-------GTTGGTAGA-GAAA-------TCCTTCCATCGAAAATTCAG-----------------AAAGGAT----------------GAAG-GATAAACA------CATA-------TACAT-ACG---------TATGGAATACTATAT-----------------CAAAT-----GATTA-TGC-C----GACCCGAATTCTT----CCGTATTT-TTTCTATAA----AAAACGGAAGAATT------GGTGTGAG-----TCGATTCTTTCTTCAATGTGGAA-----TCGAATATTCATTGATCAAATGATTCACTCCATAGTCTG-TAGATCCCCTTT--TCAAGAAC-GG--ATTAAT-------C-GGACGA-GAA-TAAAGA-------TAGAGTCCCGTTCTACA-TGTCAATGCTGGCAACAATG-----------------AAATTTATAGT-AAGAGG   
Petunia_hybrida_X74572                  -------------CTTGGTATGGAAACTTACTAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAATTAAC---------------AA-AAATGGGCAATCCTGAGCCAAATCCTGTTTT----------------CCGAAA-------ACAAAC------------AAAGGTTCAG---------AAA--AAAAA-----------AGGATAGGTGCAGAGACTCAATGGAAGCT-ATTCTAAC-------AAATGGA--------GTTAAATG-C-------GTTGGTAGA-GGAA-------TCTTTACATCGAAACTTCAG-----------------AAAGAAT-----------GAAGTGAAG-GATAAACG------TATA-------TACAT-ACG---------TATTGAATACTATAT-----------------CAAAT-----GATTAATGA-C----GACCCGAAT--------CCGTATTTTT-TCTATAA----AAAATCGAAGAATT------GGCGTGAC-----TCGATTCTACATTGAAGAAAGAA-----TCGAATATTCATTGATCAAATCATTCACTCCATAGTCTGATAAA---TCTTT--TGAAGAACTG---ATTAAT-------C-G-ACGA-GAA-TAAAGA-------TAGAGTCCCGTTCTACA-TGTCAATACCGGCAACAATG-----------------AAATTTATAGT-AAGAGG   
Portlandia_platantha_AF102469           -ATTGGATTGAGCCTTGGTATGGAAACCCACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAAGGGGCAATCCTGAGCCAAATCCTGTTTT----------------TCGAAA-------CC----------------AAAGGTTCAG---------AAAGTGAAAAAAAAAAAAA--AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGGCTG-C-------GTTAGTAGA-GAAA-------TCTTTCCATCCAAAATTCAG-----------------AAAGAAT-----------GAAGTGAAG-GAGAAACG------TATA-------TACAT-ACG---------TATTGAATACTATAT-----------------CAAAT-----GATTAATGA-A----GACTCGACGGAAT----CCGTATTTTTATATATGA----AAAACGGAAGAATT------AATGTGAA-----TAGATTCCACATTGAAGAAAGAA-----TCGAATATTCATTGATCAAATGATTCACTCCATAGTCCGATAGT---TCTTT--TCAAGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------TAGAGTCCTGTTCTACA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-AAGAGG   
Potalia_amara_AF102470                  AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------CTTTTTCCAAAAA-------CAAAAAG----------AAAGGCTCAG---------AAAGAAAAAAAAA--------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAAA-GAAA-------CCTTTGCATCAAAAATTCCG-----------------AAAGTAT----------------AAAG-AA-AAAGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCACAGCCTG-TAGA---TCTTT--TCACGAACTG---ATTACT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTACA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-AAGAGG   
Potalia_resinifera_AF102471             AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCC?ATTTTT---------CTTTTTCCAAAAA-------CAAAAAG----------AAAGGCTCAG---------AAAGAAAAAAAAA--------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAAA-GAAA-------CCTTTGCATCAAAAATTCCG-----------------AAAGTAT----------------AAAG-AA-AAAGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCACAGCCTG-TAGA---TCTTT--TCACGAACTG---ATTACT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-AAGAGG   
Potalia_resinifera_AF102472             AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCGATTTTT---------CTTTTTCCAAAAA-------CAAAAAG----------AAAGGCTCAG---------AAAG?AAAAAAAA--------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAAA-GAAA-------CCTTTGCATCAAAAATTCCG-----------------AAAGTAT----------------AAAG-AA-AAAGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCACAGCCTG-TAGA---TCTTT--TCACGAACTG---ATTACT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-AAGAGG   
Pycnosphaera_buchananii_AF102473        AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTTT----------TTTTTCAAAAA-CAAAAAGCAAAAAG----------AAAGTCTCAT---------AAAGCAAAAAAAA--------AGGATAGGTGCAGAGACTCAACGGAAGTT-GTTCTAAC-------AAATGGA--------GTTGATTA-C-------GTTGGTAAA-GAAA-------CCTTTGCATCAAAAATTTCG-----------------AAAGGATAAAAAAGGAT------ACAG-AAGAAAGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAT-CCACAGCCTT-TCGA---TCTTT--TCACGAACTG---ATTAAT-------C-GTACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-AAGAGG   
Rondeletia_amoena_AF102474              -ATTGGATTGAGCCTTGGTATGGAAACCCACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCCGTTTT----------------CCGAAA-------CCAAAT------------CTAGGTTCAG---------AAAGTGAAAAAAA--------AGGATAGGTGCAGAGACTCAACGGAAGTT-GTTCTAAC-------AAATGGA--------GTTGGCTG-C-------GTTAGTAGA-GAAA-------TCTTTCCATCGAAAATTCAA-----------------AAAGAAT-----------GAAGTGAAG-GATAAACG------TATA-------TACAT-ACG---------TATTAAATACTATAT-----------------CAAAT-----GATTAATGA-C----GACCCGACTGAAT----CTGTATTTTTATATATGA----AAAACGGAAGAATT------GGTGTGAA-----TAGATTCCACATTGAAGAAAGAA-----TCGAATATTCATTGATCAAATGATTCACTCCATAGTCTGATAGA---TCTTT--TCAAGAACTT---ATTAAT-------C-GGACGA-GAA-TAAAGA-------TAGAGTCCCGTTCTACA-TGTCAATGCCGGCAACAATG-----------------AAATTTATAGT-AAAAGG   
Rubia_fruticosa_AF102475                -ATTGGATTGGGCCTTGGTATGGAAACCTGCTGAGTGAGAACTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAAGGGGCAATCCTGAGCCAAATCCTATTTT----------------CCGAAA-------AC----------------AAAGGTTTAG---------AAAGTGAAAAAG---------GGGATAGGTGCAGAGACTCAATGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGGCTG-C-------GTTAGTCGA-GAAT-------TCTTTCCATCAAAAATTCAG--------AAAA-TA--CAAGTAT-----------TAAGTGAAG-GATAAACG------TATATAC--TATACAT-ACG---------TAGTGAATAGTATAG-----------------TAAAT-----CAGAAATCA-C----AGCCCCAATGAAT----CTATATTTTTTCATA-GA---AAAAATAT-AGAATTGTAATTGTTGTTAA-----AAGATTGCACGTTTAAGAAAGAA-----TCGAATATTCATTTATCAAATGATTCACTCCATAGTCTGATAGA---TCTTT--TTACGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------TAGAGTCCCATTCTACA-TGTCAATGCCGGCAACAATG-----------------AAATTTATAGTTAAGAGG   
Sabatia_angularis_AF102476              AATTGGATTGAGCCTTGGTATGGAAACCTACTGAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AATAAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------ATTTTTCCAAAA-------ACAAAAAG--GAAAT---AAAGGCTCAG---------AAAGCAAAAAAA---------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAGA-GAAA-------TATTTCCATCGAAAATTCCG-----------------AAAGGAT----------------GAAG-AAGAAAGG------TATA-------TACAT-ACG---------GATGGAAGACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCATAGCCTG-TAGA---TCTTT--TCAAGATCTG---ATAAAT-------C-AGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAAGAATG-----------------AAATTTATAGT-AAGAGG   
Sabatia_gentianoides_AF102477           AATTGGATTGAGCCTTGGTATGGAAACCTACTGAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AATAAA-GGGCAATCCTGAGCCAAATCCTTTTTTT---------ATTTTTCCAAAA-------ACAAAAAG--GAAAT---AAAGGCTCAG---------AAAGCAAAAAAAA--------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAGA-GAAA-------TATTTCCATCGAAAATTCCG-----------------AAAGGAT----------------GAAG-AAGAAAGG------TATA-------TACAT-ACG---------GATGGAAGACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCATAGCATG-TAGA---TCTTT--TCAAGATCTG---ATAAAT-------C-AGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTACA-TGTCAATACCGACAAGAATG-----------------AAATTTATAGT-AAGAGG   
Saccifolium_bandeirae_AF102478          AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTTTT--------------CAAAAAA------GCAAAAAAG---------AAGCGCTTAG-------T-AAAGAAATAA-----------AGGATAGGTGCAGAGACTCAACGGAA?CT-GTTTTATC-------ATATGTA--------GTTG??TG-C-------GTTGGTAAA-GAAA-------CTTTTTCACCAAAAATCCAG-----------------AAAGGAT----------------GAAG-AAGAAAGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCACAGCCTG-TAGA---TCTTT--TCACGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-AAGAGG   
Schinziella_tetragona_AF102479          AATTGGATTGAGCCTTGGTATGGAAACCTACTGAGTGAAAATTTTCAAATTCAGCGAAACTCTGGAATTAAA---------------AAAAAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------------CAAAAA-------ACAAAAAG----------AAAGGCCCAG---------AAAG-AAAAAA----------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-CATTGGT-GTTGGTAGA-GAAA-------TATTTCCATCAAAAATTCCG-----------------AAAGGAT----------------AAAT-AAGAAA-----------A-------TACAT-ACG---------TATGAAAAACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAGTGATTCAC-CCATCTCTTG-TAGA---TCTTT--TCAAGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTACA-TGTCAATGCCGACAAGAATG-----------------AAATTTATAGT-AAGAGG   
Schultesia_guianensis_AF102480          AATTGGATTGAGCCTTGGTATGGATACCTACTGAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------------CCAAAA-------ACAAAAAG--AAAAG---AAAGGTTCAG---------AAAGCAAAAAAAA--------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAGA-GAAA-------TAGTTCCATCGAAAATTCCG-----------------AAAGGAT----------------GAAG-AAGAAAGG------TATA-------TACAT-ACG---------TATGGAAGACTGTAT-----------------CAAAT-----GATT-----------------------------------------------------------------------------------------------------------------------CACCCTATCAAATGATTCAC-CCATAGCCTG-TAGA---TCTTT--TCAAGAACTA---ATTAATAATTAATC-GGATGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCAACAAAAATGCATTGCCGACAAGAATGAAATTTATAGT-AAGAGG   
Sebaea_exacoides_AF102481               AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAACTTTCCAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTT------------CTTTCTGAAA-------AG----------------AAAGGTTCAG---------AAAGCAAAAAA----------GGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTA-C-------GTTGGTAGA-TAAATGATAAATCTTTCCTTCAAAA-TTTCG-----------------AAAGGAT----------------GAAG-AAGAAGGG------TCTA-------TACAT-ACG---------TATGGAATATTGTAT-----------------CA---------------GA-T----GACCCGAATAAAT----CTGTATTTTT-TCTAGGA----AAAGTGGAAGAATT------AGTGTGAA-----GCGATTCCACATTCAAGAAAATA-----TATAATATTCATTGAACAAATGTTTCACTCCATAGTCTG-TAGG---TCTTT--TTAAGAACT----AGTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATACCGACAACAATG-----------------CAATTTATAGT-AAGAGG   
Sebaea_cf_macrophylla_AF102482          AATTGGATTGAGCGTTGGTATGGAAACCTACTAAGTGATAACTTTCCAATTCAGAGAAACC-TGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTT------------CTTT?TGAAA-------AG----------------AAAGGTTCAG---------AAAGCAAAAAA----------GGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTA-C-------GTTGGTAGA-TAAA-------TCTTTCCTTCAAAA-TTTCG-----------------AAAGGAT----------------GAAG-AAGAAGGG------TCTA-------TACAT-ACG---------TATGGAATATTGTAT-----------------CA---------------GA-T----GACCCGAATAAAT----CTGTATTTTT-TCTAGGA----AAAGTGGAAGAATT------AGTGTGAA-----GCGATTCCACATTCAAGAAAATA-----TATAATATTCATTGAACAAATGTTTCACTCCATAGTCTG-TAGG---TCTTT--TTAAGAACT----AGTAGT-------C-AGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATACCGACAACAATG-----------------CAATTTATA?T-AAGAAG   
Stapelia_peglerae_AF102483              AATTGGATTGAGCCTTGGTAAGGAAACCTACTAAGTGATGACTTTCAAATTCAGAGAAACCCCGGAATTAAG---------------AA-AAA-GGGCAATTCTGAGCCAAATCCTATTTT------------------------------------------------CAGGTTCGG---------AAAACGAACACA---------AGGATAGGTGCAGAGACTCGACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGGCCG-C-------GTTGGTAGA-GAAA-------TCTTTCCATCGAAAATTCAG-----------------AAAGGAT----------------GAAA-G--------------ATA-------TACAT-ACG---------TATTGAATACTATAG-----------------AAAAT-----TATTAATGA-C----AATCCAAATTCTT----CCGT--TT-TTTATAGAA----AAAACGGAAGAATT------GGTGTGAT-----TCGATTCCACATTGAAGAAAGAA-----TCGAATATTCATTGATCAAAAGATTCACTCCATAGTCTG-TAGATCCTCTTT--TCAAGAACCGG--ATTAAT-------C-GGACGA-GAA-TAAAGAATAAAGATAGAGTCCCGTTCTACA-TGTCAATGCTGGCAACAATG-----------------CAATTTTGAGT-AAGAGG
Strychnos_tomentosa_AF102485            -ATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAACTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTGTTTT----------------CCGAAA-------AC----------------AAAGGTTCAG---------AA-GCGAAAAA----------GGGATAGGTGCAGAGACTCAACGGAAGCT-ATTCTAAC-------AAATGGA--------GTTGGCTG-C-------GTTGGTAGA-GAAA-------TCTTTCCATCGAAAATTCAG-----------------A----------------------GAAG-GATAAACG------TATA-------TACAT-ACG---------TATTAAATACTATAT-----------------CAAAT-----GATTAATGA-C----GACCCGAATGAAT----CTGTATTTTTTTATATGA----AAAATGGAAGAATT------GGTGTGAA-----TCGATTCCACATTGAAGAAAGAA-----TCGAATATTCATTGATCAAATGATTCACTCCATAGTCTG-TAGA---TCTTT--TCAAGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------TAGAGTCCCGTTCTACA-TGTCAATGCCGGCAACAATG-----------------AAATTTATAGT-AAGAGG   
Strychnos_nux-vomica_AF02484            AATTGGATTGAGCCTTGGTATGG?AACCTACTAAGTG?TAACTTTCAAATTCAGAGAAACCCTGGAATTATT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTGTTTT----------------CCGAAA-------AC----------------AAAGGTTCAG---------AA-GCGAAAAA----------GGGATAGGTGCAGAGACTCAACGGAAGCT-ATTCTAAC-------AAATGGA--------GTTGGCTG-C-------GTTGGTAGA-TAAA-------TCTTTCCATCGAAAATTCAG-----------------A----------------------GAAG-GATAAACG------TATA-------TACAT-ACG---------TATTTAATACTATAT-----------------CAAAT-----GATTAATGA-C----GACCCGAATGAAT----CTGTATTTTTTTATATTA----AAAATGGAAGAATT------GGTGTGAA-----TCGATTCCACATTGAACAAAGAA-----TCGAATATTCATTGATCAAATGATTCACTCCATAGTCTG-TAGA---TCTTT--TCAAGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------TAGAGTCCCGTTCTACA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-AAGAGG   
Swertia_marginata_AF102486              AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGCTAATTTTCAAATTCAGAGAAACCTTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------------CAAAAAA------GCAAAAAG--AAAAG---AACAGCTCAG---------AAA-AAAA-------------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAAA-GAAA-------CCTTTTCACCAAAAATTCCG-----------------AAAGGAT----------------GAAA-AAGAAAGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCACAGCCTG-TAGA---TCTTT--TCACGAAATG---ATTAAT-------C-GTACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-GAGAGG   
Swertia_perennis_X75708                 AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------------CAAAAAA------GCAAAAAG--AAAAGA--GACGGCTCAG---------AAA-AAAA-------------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAA-GGA--------GTTGATTG-C-------GTTGGTAAA-GAAA-------CCTTTTCACCAAAAATTCCG-----------------AAAGGAT----------------GAAA-AAGAAAGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCACAGCTTG-TAGA---TCTTT--TCACGAAATG---ATTAAT-------C-GTACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-GAGAGG   
Symbolanthus_sp_AF102487                AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAATAATATTAATAATAATAA-AAA-GGGCAATTCTGAGCCAAATCCTATTTTT---------CTTTTTCAAAAA-------GCAAAAAG----------AAAGGCTCAG---------AAAGCAAAAAAAAA-------GGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGGAAA-GAAA-------CCTTTCCATCAAAAATTCCG-----------------AAAGGAT----------------GAAG-AAGAAAGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCCCAGCCTG-TAGA---TCTTT--TCACGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-AAGAGG   
Symbolanthus_pulcherrimus_AF102488      AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAATAATATTAATAATAAAAA-AAA-GGGCAATTCTGAGCCAAATCCTATTTTTT--------CTTTTTCAAAAA-------GCAAAAAG----------AAAGGCTCAG---------AAAGCAAAAAAAAA-------GGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGGAAA-GAAA-------CCTTTCCATCAAAAATTCCG-----------------AAAGGAT----------------GAAG-AAGAAAGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCCCAGCC?G-TAGA---TCTTT--TCACGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATATT-AAGAGG   
Symbolanthus_cf_calygonus_AF102489      AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAATAATATTAATAATAATAA-AAA-GGGCAATTCTGAGCCAAATCCTATTTTT---------CTTTTTCAAAAA-------GCAAAAAG----------AAAGGCTCAG---------AAAGCAAAAAAAAA-------GGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGGAAA-GAAA-------CCTTTCCATCAAAAATTCCG-----------------AAAGGAT----------------GAAG-AAGAAAGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCCCAGCCTG-TAGA---TCTTT--TCACGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-AAGAGG   
Symphyllophyton_caprifolioides_AF102490 AATTGGATTGAGCCTTAGTATGGAAACCTACTGAGTGATAATTTTCAAATTCAGAGAACCCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------------CCAAAA-------ACAAAAAG--AAAAG---AAAGGTTCAG---------AAAGCAAAAAAA---------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAGA-GAAA-------TAGTTCCATCGAAAATTCCG-----------------AAAGGAT----------------GAAG-AAGAAAGG------TATA-------TACAT-ACG---------TATGGAAGACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCATAGCCTG-TAGA---TCTTT--TCAAGAACTA---ATTAAT-------C-AGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCAACAAGAATGCATTGCCGACAAGAATGAAATTTATAGT-AAGAGG   
Tachiadenus_carinatus_AF102491          AATTGGATTGAGCCTTGGTATGGAAACCTA?TAAGTGATAACTTTCCAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTT------------TTTTACGAAA-------AG----------------AAAGGTTCAG---------AAAGCAAAAAA----------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAAA-TAAA-------TCTTTCCTTCGAAAATTCCG-----------------AAAGGAT----------------GAAG-AAGAAAGG------TATA-------TACAT-ACG---------TATGGAATATTGTAT-----------------CAAAT-----GATTAATGA-T----GACCCGAATAAAT----CTGTATTTTT-TCTATGA----AAAATGTAAGAATT------GGTGTGAA-----GCAATTCCACATTCAACAAAAAA-----TCGAATATTCGTTGATCAAATGATTCACTCCATAGTCTG-TAGG---TCTTT--TTAAGAACT----ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATAACGACAACAATG-----------------CAATTTATAGT-AAGAAG   
Tachia_loretensis_AF102492              AATTGGATTGAGCCTTGGTATGTAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------AATAATAA-AAA-GGGCAATTCTGAGCCAAATCCTATTTTTT--------CTTTTTCAAAAA-------GCAAAAAA----------------------------------AAA-------------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGGAAA-GAAA-------CCTTTCCATCCAAAATTCCG-----------------AAAGGAT----------------GAAG-AAGAAAGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCCCAGCCTG-TAGA---TCTTT--TCACGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCATTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-AAGAGG   
Telosma_cordata_AF102493                AATTGGATTGAGCCTTGGTAAGGAAACCTACTAAGTGATGACTTTCAAATTCAGAGAAACCCCGGAATTAAG---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTTT------------------------------------------------CAGGTTCAG---------AAAACGAAAACA---------AGGATAGGTGCAGAGACTCGACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGGCCG-C-------GTTGGTAGA-GAAA-------TCTTTCCATCGAAAATTCAG-----------------AAAGGAT----------------GAAA-G--------------ATA-------TACAT-ACG---------TATCGAATACTATAT-----------------CAAAT-----GATTAATGC-C----GACCCCAATGAGT----CTGTATTT-TTTCTATAA-----AAACGGAAGAATT------GGTGTGAT-----TCGATTCTTTCTTCAATGTGGAA-----TCGAATATTCATTGATCAAAAGATTCACTCCATAGTCTG-TAGATCTTCTTT--TCAAGAACTGG--ATTAAT-------C-GGACGA-GAA-TAAAGA-------TAGAGTCCCGTTCTACA-TGTCAATGCTGGCAACAATG-----------------CAATTTTGAGT-AAGAGG   
Tetrapollinia_caerulescens_AF102494     AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------AATAATAA-AAA-GGGCAATTCTGAGCCAAATCCTATTTTTT--------CTTTTTCAAAAA-------GCAAAAAA----------------------------------AAA-------------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGGAAA-GAAA-------CCTTTCCATCAAAAATTCCG-----------------AAAGGAT----------------GCAG-AAGAAGGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCCCAGCCTG-TAGA---TCTTT--TCACGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-AAGAGG   
Urogentias_ulugurensis_AF102495         AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTTTTTTT------------TTTCCAAAA-------GCAAAAAG----------AAAGGCTCAG---------AAAGAAAAAAAA---------AGGATAGGTGCAAAGACTCAACGGAAGTT-GTTCTAAC-------AAATGGA--------GTTGATTA-C-------GTTGGTAAA-GAAA-------CCTTTGCATCCAAAATTTCG-----------------AAAGGATAAAAAAGGAT------AAAG-AAGAAAGG------TATA-------TACA---------------------GACTATAT--------------------------------------------------------------------------------------------------------------------------------------------------------------TAAATGATTCAC-CCACAGCCTG-TAGA---TCCTT--TCACGAACCG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-AAGAGG   
Usteria_guineensis_AF102496             AATTAGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAACTTTCAAATTCAGAGAAATCCTGGAATTAAT---------------AA-AAA-GGGCAATTCTGAGCCAAATCCTGTTTT----------------CCGAAA-------AC----------------AAAGGTTCAG---------AAAGCGAAAAA----------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGGCTG-C-------GTTGGTAGA-GAAA-------TCTTTCCATCGAAAATTCAG-----------------AAAGGAT----------------GAAG-GATAAACG------TATA-------TACAT-ACG---------TATTGAATACTAGAT------------------------------TAATGA-C----AACCCGAATGAAT----CTGTGTTT-TTTATATGAG--AAAAATGGAAGAATT------GGTGTGAA-----TCGTTTCCACATTGAAGAAAGAA-----TCGAATATTCATTAATCAAATGATTCACTCCACAGTCT-ATAGA---TCATT--TCAACAAATG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------TAGAGTCCCGTTCTACA-TGTCAATGCCGGCAACAATG-----------------AAATTTCTAGT-AAGAGG   
Valeriana_officinalis_X85795            ------------CCTTAGTATGGAAACCTACTAAGTGAGAACTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAATGGGCAATCCTGAGCCAAATCCGGTTTTT----------GTTTTCCGAAA-------AC----------------AAAGGCT-A----------AAATCAAAAA-----------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATAGA--------GTTGACTG-G-------GTTGGTAAAAAGAA-------TCCTTCCATAGAAACTTCAG--------AAAAG----AAAGGA-----------------GAAGCTATAAACAGG----GATA-------TAC-T-AAA---------TACTATAGACTCTAC-----------------CAACT-----GATTAATGAAC----GACCCGAAT--------CTGTATTATCAAAA-TGGG---AAAAT----GA-TT---------GTGAA-----TTGATTCCATATTGAAGAAAGAA-----TCGAATACTCATTGAT?AAATCATTCACTCCATAGTCTG??CGA---TCT?T--TGAAGAACTG---ATTAAT-------C-GAACGA-GAA-TAAAGA-------TAGAGTCCCATTCTACA-TGCCAATGCCGGCAACAATG-----------------AAAT??AGAGT-AAGAGG   
Veratrilla_baillonii_AF102497           AA?TGGATTGAGCCTTGGTATGGAAACTTACTAAGTGCTAATTTTCAAATTCAGAGAAACCCTGGAATTAAT---------------AA-AAA-GGGCAATCCTGAGCCAAATCCTATTAAA---------------AAAAAAA------GCAAAAAG----------AAAGGCTCAG---------AAAGAAAAA------------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGTAAA-GAGA-------CCTTTTCACCAAAAATTCCG-----------------AAAGGAT----------------GAAA-AAGAAAGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCACAGCCTG-TAGA---TCTTT--TCACGAAATG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-GAGAGG   
Wurdackanthus_frigidus_AF02498          AATTGGATTGAGCCTTGGTATGGAAACCTACTAAGTGATAATTTTCAAATTCAGAGAAACCCTGGAATTAATAATATTAATAATAATAA-AAA-GGGCAATTCTGAGCCAAATCCTATTTTTT--------CTTTTTCAAAAA-------GCAAAAAG----------AAAGGCTCAG---------AAAGCAAAAAAAA--------GGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------AAATGGA--------GTTGATTG-C-------GTTGGGAAA-GAAA-------CCTTTCCATCAAAAATTCCG-----------------AAAGGAT----------------GAAG-AAGAAAGG------TATA-------TACA---------------------GACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGATTCAC-CCCCAGCCTG-TAGA---TCTTT--TCACGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTGCA-TGTCAATGCCGACAACAATG-----------------AAATTTATAGT-TAGAGG   
Xestaea_lisianthoides_AF102499          AATTGGATTGAGCCTTGGTATGGAAACCTACTGAGTGATAATTTTCAAATTCAGCGAAACTCTGGAATTAAT---------AATAAAAA-AAA-GGGCAATCCTGAGCCAAATCCTATTTTT---------------CAAAAA-------ACAAAAAG----------AAAGGCCCAG---------AAAG-AAAAA-----------AGGATAGGTGCAGAGACTCAACGGAAGCT-GTTCTAAC-------CAATGGA--------GTTGATTG-CGTTGGT-GTTGGTCGA-GAAA-------TATTTCCATCGAAAATTCCG-----------------AAAGGAT----------------CAAT-AAGAAAGG------TATA-------TACAT-ACG---------TATGGAAAACTGTAT--------------------------------------------------------------------------------------------------------------------------------------------------------------CAAGTGATTCAC-CCATATCTTG-TATA---TCTTT--TCAAGAACTG---ATTAAT-------C-GGACGA-GAA-TAAAGA-------GAGAGTCCCGTTCTACA-TGTCAATGCCGACAAGAATG-----------------AAATTTATAGT-AAGAGG   

*Hydrangea_paniculata_X85796;
;